EMAIL THIS PAGE TO A FRIEND

MTIF2

mitochondrial translational initiation factor 2

60 Gene Product Result for
UniProtKB ID: P46199, D6W5D0
Gene ID:
Human(4528) Summary: During the initiation of protein biosynthesis, initiation factor-2 (IF-2) promotes the binding of the initiator tRNA to the small subunit of the ribosome in a GTP-dependent manner. Prokaryotic IF-2 is a single polypeptide, while eukaryotic cytoplasmic IF-2 (eIF-2) is a trimeric protein. Bovine liver mitochondria contain IF-2(mt), an 85-kD monomeric protein that is equivalent to prokaryotic IF-2. The predicted 727-amino acid human protein contains a 29-amino acid presequence. Human IF-2(mt) shares 32 to 38% amino acid sequence identity with yeast IF-2(mt) and several prokaryotic IF-2s, with the greatest degree of conservation in the G domains of the proteins. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(76784) mitochondrial translational initiation factor 2
Rat(305606) mitochondrial translational initiation factor 2
Zebrafish(556465) mitochondrial translational initiation factor 2
domestic cat(101093177) mitochondrial translational initiation factor 2
cow(281923) mitochondrial translational initiation factor 2
dog(474600) mitochondrial translational initiation factor 2
chicken(421213) mitochondrial translational initiation factor 2
sheep(101122509) mitochondrial translational initiation factor 2
naked mole-rat(101711400) mitochondrial translational initiation factor 2
domestic guinea pig(100722149) mitochondrial translational initiation factor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133767 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133767 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133767 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002453 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002453 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002453 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU039271 MISSION® esiRNA esiRNA human MTIF2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005369 Rosetta Predictions human pricing
NM_002453 Rosetta Predictions human pricing
NM_001004254 Rosetta Predictions rat pricing
NM_133767 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005369 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198550 predicted 1175
2 SASI_Hs01_00198551 predicted 1580
3 SASI_Hs01_00198552 predicted 2260
4 SASI_Hs01_00198553 predicted 1752
5 SASI_Hs01_00198554 predicted 1493
6 SASI_Hs01_00198555 predicted 1376
7 SASI_Hs01_00198556 predicted 2282
8 SASI_Hs01_00198557 predicted 1317
9 SASI_Hs01_00198558 predicted 1703
10 SASI_Hs02_00304874 predicted 1006
11 SASI_Hs01_00198549 predicted 2371
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002453 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164895 predicted 750
2 SASI_Hs01_00164896 predicted 1153
3 SASI_Hs01_00164897 predicted 1834
4 SASI_Hs01_00164898 predicted 1333
5 SASI_Hs01_00164899 predicted 1076
6 SASI_Hs01_00164900 predicted 953
7 SASI_Hs01_00164901 predicted 1861
8 SASI_Hs01_00164902 predicted 893
9 SASI_Hs01_00164903 predicted 1286
10 SASI_Hs02_00333857 predicted 586
11 SASI_Hs01_00164894 predicted 1949
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004254 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115466 predicted 1651
2 SASI_Rn01_00115467 predicted 422
3 SASI_Rn02_00198273 predicted 1790
4 SASI_Rn01_00115468 predicted 1421
5 SASI_Rn01_00115469 predicted 1238
6 SASI_Rn01_00115470 predicted 862
7 SASI_Rn01_00115471 predicted 1711
8 SASI_Rn01_00115472 predicted 1696
9 SASI_Rn01_00115473 predicted 1120
10 SASI_Rn01_00115474 predicted 932
11 SASI_Rn01_00115475 predicted 402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133767 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080039 predicted 630
2 SASI_Mm02_00338771 predicted 422
3 SASI_Mm01_00080041 predicted 2079
4 SASI_Mm02_00338772 predicted 2384
5 SASI_Mm01_00080044 predicted 770
6 SASI_Mm01_00080045 predicted 756
7 SASI_Mm01_00080046 predicted 1228
8 SASI_Mm01_00080047 predicted 1669
9 SASI_Mm02_00338773 predicted 476
10 SASI_Mm01_00080048 predicted 1147
11 SASI_Mm01_00080040 predicted 1995
12 SASI_Mm01_00080042 predicted 444
13 SASI_Mm01_00080043 predicted 394
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133767
VALIDATED
MTIF2 MISSION shRNA Bacterial Glycerol Stock
mitochondrial translational initiation factor 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133767.2-755s21c1
Sequence:CCGGGCCATTGACGTAGATTCATTACTCGAGTAATGAATCTACGTCAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133767.2-2508s21c1
Sequence:CCGGCGGGAGATCAAGTCATTTGTTCTCGAGAACAAATGACTTGATCTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133767.1-391s1c1
Sequence:CCGGGCCATTGACGTAGATTCATTACTCGAGTAATGAATCTACGTCAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133767.1-2259s1c1
Sequence:CCGGACGCCTTTAATCCCAGCACTTCTCGAGAAGTGCTGGGATTAAAGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133767.1-1054s1c1
Sequence:CCGGGCAGAAATCTTGGAACTGAAACTCGAGTTTCAGTTCCAAGATTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133767.1-2144s1c1
Sequence:CCGGCGGGAGATCAAGTCATTTGTTCTCGAGAACAAATGACTTGATCTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133767.1-1652s1c1
Sequence:CCGGCCCACGAATGTGAACTCGAATCTCGAGATTCGAGTTCACATTCGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133767.2-1418s21c1
Sequence:CCGGGCAGAAATCTTGGAACTGAAACTCGAGTTTCAGTTCCAAGATTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133767.2-2016s21c1
Sequence:CCGGCCCACGAATGTGAACTCGAATCTCGAGATTCGAGTTCACATTCGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133767
VALIDATED
MTIF2 MISSION shRNA shRNA Plasmid DNA
mitochondrial translational initiation factor 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133767.2-755s21c1
Sequence:CCGGGCCATTGACGTAGATTCATTACTCGAGTAATGAATCTACGTCAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133767.2-2508s21c1
Sequence:CCGGCGGGAGATCAAGTCATTTGTTCTCGAGAACAAATGACTTGATCTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133767.1-391s1c1
Sequence:CCGGGCCATTGACGTAGATTCATTACTCGAGTAATGAATCTACGTCAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133767.1-2259s1c1
Sequence:CCGGACGCCTTTAATCCCAGCACTTCTCGAGAAGTGCTGGGATTAAAGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133767.1-1054s1c1
Sequence:CCGGGCAGAAATCTTGGAACTGAAACTCGAGTTTCAGTTCCAAGATTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133767.1-2144s1c1
Sequence:CCGGCGGGAGATCAAGTCATTTGTTCTCGAGAACAAATGACTTGATCTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133767.1-1652s1c1
Sequence:CCGGCCCACGAATGTGAACTCGAATCTCGAGATTCGAGTTCACATTCGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133767.2-1418s21c1
Sequence:CCGGGCAGAAATCTTGGAACTGAAACTCGAGTTTCAGTTCCAAGATTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133767.2-2016s21c1
Sequence:CCGGCCCACGAATGTGAACTCGAATCTCGAGATTCGAGTTCACATTCGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133767
VALIDATED
MTIF2 MISSION shRNA Lentiviral Transduction Particles
mitochondrial translational initiation factor 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133767.2-755s21c1
Sequence:CCGGGCCATTGACGTAGATTCATTACTCGAGTAATGAATCTACGTCAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133767.2-2508s21c1
Sequence:CCGGCGGGAGATCAAGTCATTTGTTCTCGAGAACAAATGACTTGATCTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133767.1-391s1c1
Sequence:CCGGGCCATTGACGTAGATTCATTACTCGAGTAATGAATCTACGTCAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133767.1-2259s1c1
Sequence:CCGGACGCCTTTAATCCCAGCACTTCTCGAGAAGTGCTGGGATTAAAGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133767.1-1054s1c1
Sequence:CCGGGCAGAAATCTTGGAACTGAAACTCGAGTTTCAGTTCCAAGATTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133767.1-2144s1c1
Sequence:CCGGCGGGAGATCAAGTCATTTGTTCTCGAGAACAAATGACTTGATCTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133767.1-1652s1c1
Sequence:CCGGCCCACGAATGTGAACTCGAATCTCGAGATTCGAGTTCACATTCGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133767.2-1418s21c1
Sequence:CCGGGCAGAAATCTTGGAACTGAAACTCGAGTTTCAGTTCCAAGATTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133767.2-2016s21c1
Sequence:CCGGCCCACGAATGTGAACTCGAATCTCGAGATTCGAGTTCACATTCGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002453
VALIDATED
MTIF2 MISSION shRNA Bacterial Glycerol Stock
mitochondrial translational initiation factor 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002453.1-655s1c1
Sequence:CCGGGCAGACTCACATTTAGATGAACTCGAGTTCATCTAAATGTGAGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002453.1-1731s1c1
Sequence:CCGGGAAGAGATCAATTCTACGGTTCTCGAGAACCGTAGAATTGATCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002453.1-454s1c1
Sequence:CCGGGCTTTATCTCAGTATAGGCTTCTCGAGAAGCCTATACTGAGATAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002453.1-2255s1c1
Sequence:CCGGCCCGTAATGGACATGTAATTTCTCGAGAAATTACATGTCCATTACGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002453.1-777s1c1
Sequence:CCGGCCAGGCAGATCCAGCTTTATTCTCGAGAATAAAGCTGGATCTGCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002453.1-2134s1c1
Sequence:CCGGCCAGTAGGTGAGGCATCTATACTCGAGTATAGATGCCTCACCTACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002453.1-1114s1c1
Sequence:CCGGCCTATTATCCTTGCCGTAAATCTCGAGATTTACGGCAAGGATAATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002453.1-2158s1c1
Sequence:CCGGGCTACCTTCTCTGTAACAGAACTCGAGTTCTGTTACAGAGAAGGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002453.1-1702s1c1
Sequence:CCGGCGTGAGAAGTATGGCCATCTACTCGAGTAGATGGCCATACTTCTCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002453.1-1549s1c1
Sequence:CCGGGCAGGAGAAGAAATTCTTGAACTCGAGTTCAAGAATTTCTTCTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002453.1-355s1c1
Sequence:CCGGGCATTAAGACAGTGGAGGCATCTCGAGATGCCTCCACTGTCTTAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002453
VALIDATED
MTIF2 MISSION shRNA shRNA Plasmid DNA
mitochondrial translational initiation factor 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002453.1-655s1c1
Sequence:CCGGGCAGACTCACATTTAGATGAACTCGAGTTCATCTAAATGTGAGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002453.1-1731s1c1
Sequence:CCGGGAAGAGATCAATTCTACGGTTCTCGAGAACCGTAGAATTGATCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002453.1-454s1c1
Sequence:CCGGGCTTTATCTCAGTATAGGCTTCTCGAGAAGCCTATACTGAGATAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002453.1-2255s1c1
Sequence:CCGGCCCGTAATGGACATGTAATTTCTCGAGAAATTACATGTCCATTACGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002453.1-777s1c1
Sequence:CCGGCCAGGCAGATCCAGCTTTATTCTCGAGAATAAAGCTGGATCTGCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002453.1-2134s1c1
Sequence:CCGGCCAGTAGGTGAGGCATCTATACTCGAGTATAGATGCCTCACCTACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002453.1-1114s1c1
Sequence:CCGGCCTATTATCCTTGCCGTAAATCTCGAGATTTACGGCAAGGATAATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002453.1-2158s1c1
Sequence:CCGGGCTACCTTCTCTGTAACAGAACTCGAGTTCTGTTACAGAGAAGGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002453.1-1702s1c1
Sequence:CCGGCGTGAGAAGTATGGCCATCTACTCGAGTAGATGGCCATACTTCTCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002453.1-1549s1c1
Sequence:CCGGGCAGGAGAAGAAATTCTTGAACTCGAGTTCAAGAATTTCTTCTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002453.1-355s1c1
Sequence:CCGGGCATTAAGACAGTGGAGGCATCTCGAGATGCCTCCACTGTCTTAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002453
VALIDATED
MTIF2 MISSION shRNA Lentiviral Transduction Particles
mitochondrial translational initiation factor 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002453.1-655s1c1
Sequence:CCGGGCAGACTCACATTTAGATGAACTCGAGTTCATCTAAATGTGAGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002453.1-1731s1c1
Sequence:CCGGGAAGAGATCAATTCTACGGTTCTCGAGAACCGTAGAATTGATCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002453.1-454s1c1
Sequence:CCGGGCTTTATCTCAGTATAGGCTTCTCGAGAAGCCTATACTGAGATAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002453.1-2255s1c1
Sequence:CCGGCCCGTAATGGACATGTAATTTCTCGAGAAATTACATGTCCATTACGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002453.1-777s1c1
Sequence:CCGGCCAGGCAGATCCAGCTTTATTCTCGAGAATAAAGCTGGATCTGCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002453.1-2134s1c1
Sequence:CCGGCCAGTAGGTGAGGCATCTATACTCGAGTATAGATGCCTCACCTACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002453.1-1114s1c1
Sequence:CCGGCCTATTATCCTTGCCGTAAATCTCGAGATTTACGGCAAGGATAATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002453.1-2158s1c1
Sequence:CCGGGCTACCTTCTCTGTAACAGAACTCGAGTTCTGTTACAGAGAAGGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002453.1-1702s1c1
Sequence:CCGGCGTGAGAAGTATGGCCATCTACTCGAGTAGATGGCCATACTTCTCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002453.1-1549s1c1
Sequence:CCGGGCAGGAGAAGAAATTCTTGAACTCGAGTTCAAGAATTTCTTCTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002453.1-355s1c1
Sequence:CCGGGCATTAAGACAGTGGAGGCATCTCGAGATGCCTCCACTGTCTTAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)