EMAIL THIS PAGE TO A FRIEND

MTL5

metallothionein-like 5, testis-specific (tesmin)

99 Gene Product Result for
Synonyms: CXCDC2 MTLT TESMIN
UniProtKB ID: Q9Y4I5, A8K8J3, Q4G182, Q6P2E2, Q8NCC8
Gene ID:
Human(9633) Summary: Metallothionein proteins are highly conserved low-molecular-weight cysteine-rich proteins that are induced by and bind to heavy metal ions and have no enzymatic activity. They may play a central role in the regulation of cell growth and differentiation and are involved in spermatogenesis. This gene encodes a metallothionein-like protein which has been shown to be expressed differentially in mouse testis and ovary. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(17771) metallothionein-like 5, testis-specific (tesmin)
Rat(309142) metallothionein-like 5, testis-specific (tesmin)
chicken(768517) metallothionein-like 5, testis-specific (tesmin)
domestic cat(101095856) metallothionein-like 5, testis-specific (tesmin)
cow(523398) metallothionein-like 5, testis-specific (tesmin)
dog(611767) metallothionein-like 5, testis-specific (tesmin)
sheep(101122562) metallothionein-like 5, testis-specific (tesmin)
naked mole-rat(101711553) metallothionein-like 5, testis-specific (tesmin)
domestic guinea pig(100714751) metallothionein-like 5, testis-specific (tesmin)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004923 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004923 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004923 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010841 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010841 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010841 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039656 Rosetta Predictions human pricing
NM_004923 Rosetta Predictions human pricing
NM_001012069 Rosetta Predictions rat pricing
XM_574592 Rosetta Predictions rat pricing
NM_001039657 Rosetta Predictions mouse pricing
NM_001039658 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039656 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020212 predicted 754
2 SASI_Hs02_00308620 predicted 764
3 SASI_Hs01_00020213 predicted 764
4 SASI_Hs01_00020215 predicted 647
5 SASI_Hs01_00020216 predicted 721
6 SASI_Hs01_00020217 predicted 629
7 SASI_Hs01_00020218 predicted 356
8 SASI_Hs02_00308621 predicted 620
9 SASI_Hs02_00308622 predicted 629
10 SASI_Hs01_00020220 predicted 631
11 SASI_Hs01_00020214 predicted 621
12 SASI_Hs01_00020219 predicted 801
13 SASI_Hs01_00020221 predicted 494
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004923 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028672 predicted 754
2 SASI_Hs02_00338588 predicted 760
3 SASI_Hs01_00028673 predicted 768
4 SASI_Hs01_00028675 predicted 656
5 SASI_Hs01_00028676 predicted 719
6 SASI_Hs01_00028677 predicted 627
7 SASI_Hs01_00028678 predicted 356
8 SASI_Hs02_00338589 predicted 628
9 SASI_Hs02_00338590 predicted 794
10 SASI_Hs01_00028680 predicted 625
11 SASI_Hs01_00028674 predicted 619
12 SASI_Hs01_00028679 predicted 806
13 SASI_Hs01_00028681 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012069 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112971 predicted 561
2 SASI_Rn01_00112972 predicted 933
3 SASI_Rn01_00112974 predicted 1052
4 SASI_Rn01_00112975 predicted 1108
5 SASI_Rn01_00112976 predicted 1090
6 SASI_Rn02_00200178 predicted 742
7 SASI_Rn01_00112978 predicted 485
8 SASI_Rn01_00112979 predicted 499
9 SASI_Rn01_00112980 predicted 1264
10 SASI_Rn02_00200179 predicted 1047
11 SASI_Rn01_00112973 predicted 1136
12 SASI_Rn01_00112977 predicted 1361
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574592 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00190255 predicted 740
2 SASI_Rn01_00190256 predicted 745
3 SASI_Rn01_00190257 predicted 721
4 SASI_Rn01_00190258 predicted 693
5 SASI_Rn01_00190259 predicted 707
6 SASI_Rn01_00190260 predicted 663
7 SASI_Rn01_00190261 predicted 726
8 SASI_Rn01_00190262 predicted 661
9 SASI_Rn01_00190263 predicted 746
10 SASI_Rn01_00190264 predicted 713
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039657 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085531 predicted 386
2 SASI_Mm01_00085532 predicted 385
3 SASI_Mm01_00085533 predicted 369
4 SASI_Mm01_00085534 predicted 446
5 SASI_Mm02_00290175 predicted 380
6 SASI_Mm01_00085537 predicted 644
7 SASI_Mm02_00290176 predicted 536
8 SASI_Mm01_00085539 predicted 534
9 SASI_Mm02_00290177 predicted 370
10 SASI_Mm02_00290178 predicted 201
11 SASI_Mm01_00085535 predicted 616
12 SASI_Mm01_00085536 predicted 563
13 SASI_Mm01_00085538 predicted 433
14 SASI_Mm01_00085540 predicted 505
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039658 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034557 predicted 384
2 SASI_Mm01_00034558 predicted 382
3 SASI_Mm01_00034559 predicted 371
4 SASI_Mm01_00034560 predicted 448
5 SASI_Mm02_00290179 predicted 380
6 SASI_Mm01_00034563 predicted 645
7 SASI_Mm02_00290180 predicted 532
8 SASI_Mm01_00034565 predicted 537
9 SASI_Mm02_00290181 predicted 370
10 SASI_Mm02_00290182 predicted 197
11 SASI_Mm01_00034561 predicted 617
12 SASI_Mm01_00034562 predicted 557
13 SASI_Mm01_00034564 predicted 430
14 SASI_Mm01_00034566 predicted 510
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004923
VALIDATED
MTL5 MISSION shRNA Bacterial Glycerol Stock
metallothionein-like 5, testis-specific (tesmin)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004923.3-1425s21c1
Sequence:CCGGTACCTGCCACCAACGAAATTTCTCGAGAAATTTCGTTGGTGGCAGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004923.3-757s21c1
Sequence:CCGGATTCCAACCCAATGGTGATATCTCGAGATATCACCATTGGGTTGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004923.3-1287s21c1
Sequence:CCGGGAGTGCTATGAGGCCCAAATTCTCGAGAATTTGGGCCTCATAGCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004923.3-1624s21c1
Sequence:CCGGTTCTCCACACTGAGTTTAAATCTCGAGATTTAAACTCAGTGTGGAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004923.3-1120s21c1
Sequence:CCGGACAACTTGCATCATGATATTGCTCGAGCAATATCATGATGCAAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004923.3-630s21c1
Sequence:CCGGGGTGGTACTACTACAAGTAATCTCGAGATTACTTGTAGTAGTACCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004923.3-1854s21c1
Sequence:CCGGGCATGGCCTGAGCATTGTTTGCTCGAGCAAACAATGCTCAGGCCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107890    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004923.2-2093s1c1
Sequence:CCGGGCTGTTGTGATACCACTTAAACTCGAGTTTAAGTGGTATCACAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004923.2-1314s1c1
Sequence:CCGGCCCAAATTATGTGTTCTTCTACTCGAGTAGAAGAACACATAATTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004923.2-292s1c1
Sequence:CCGGCCACGTCTTCAAAGAAGCGTACTCGAGTACGCTTCTTTGAAGACGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004923.2-1371s1c1
Sequence:CCGGGCCCAGAACGAAAGACACTAACTCGAGTTAGTGTCTTTCGTTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004923.2-677s1c1
Sequence:CCGGGCAACTTTGCAGAATCTTCTTCTCGAGAAGAAGATTCTGCAAAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004923
VALIDATED
MTL5 MISSION shRNA shRNA Plasmid DNA
metallothionein-like 5, testis-specific (tesmin)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004923.3-1425s21c1
Sequence:CCGGTACCTGCCACCAACGAAATTTCTCGAGAAATTTCGTTGGTGGCAGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004923.3-757s21c1
Sequence:CCGGATTCCAACCCAATGGTGATATCTCGAGATATCACCATTGGGTTGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004923.3-1287s21c1
Sequence:CCGGGAGTGCTATGAGGCCCAAATTCTCGAGAATTTGGGCCTCATAGCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004923.3-1624s21c1
Sequence:CCGGTTCTCCACACTGAGTTTAAATCTCGAGATTTAAACTCAGTGTGGAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004923.3-1120s21c1
Sequence:CCGGACAACTTGCATCATGATATTGCTCGAGCAATATCATGATGCAAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004923.3-630s21c1
Sequence:CCGGGGTGGTACTACTACAAGTAATCTCGAGATTACTTGTAGTAGTACCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004923.3-1854s21c1
Sequence:CCGGGCATGGCCTGAGCATTGTTTGCTCGAGCAAACAATGCTCAGGCCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107890    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004923.2-2093s1c1
Sequence:CCGGGCTGTTGTGATACCACTTAAACTCGAGTTTAAGTGGTATCACAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004923.2-1314s1c1
Sequence:CCGGCCCAAATTATGTGTTCTTCTACTCGAGTAGAAGAACACATAATTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004923.2-292s1c1
Sequence:CCGGCCACGTCTTCAAAGAAGCGTACTCGAGTACGCTTCTTTGAAGACGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004923.2-1371s1c1
Sequence:CCGGGCCCAGAACGAAAGACACTAACTCGAGTTAGTGTCTTTCGTTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004923.2-677s1c1
Sequence:CCGGGCAACTTTGCAGAATCTTCTTCTCGAGAAGAAGATTCTGCAAAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004923
VALIDATED
MTL5 MISSION shRNA Lentiviral Transduction Particles
metallothionein-like 5, testis-specific (tesmin)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004923.3-1425s21c1
Sequence:CCGGTACCTGCCACCAACGAAATTTCTCGAGAAATTTCGTTGGTGGCAGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004923.3-757s21c1
Sequence:CCGGATTCCAACCCAATGGTGATATCTCGAGATATCACCATTGGGTTGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004923.3-1287s21c1
Sequence:CCGGGAGTGCTATGAGGCCCAAATTCTCGAGAATTTGGGCCTCATAGCACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004923.3-1624s21c1
Sequence:CCGGTTCTCCACACTGAGTTTAAATCTCGAGATTTAAACTCAGTGTGGAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004923.3-1120s21c1
Sequence:CCGGACAACTTGCATCATGATATTGCTCGAGCAATATCATGATGCAAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004923.3-630s21c1
Sequence:CCGGGGTGGTACTACTACAAGTAATCTCGAGATTACTTGTAGTAGTACCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004923.3-1854s21c1
Sequence:CCGGGCATGGCCTGAGCATTGTTTGCTCGAGCAAACAATGCTCAGGCCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107890    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004923.2-2093s1c1
Sequence:CCGGGCTGTTGTGATACCACTTAAACTCGAGTTTAAGTGGTATCACAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004923.2-1314s1c1
Sequence:CCGGCCCAAATTATGTGTTCTTCTACTCGAGTAGAAGAACACATAATTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004923.2-292s1c1
Sequence:CCGGCCACGTCTTCAAAGAAGCGTACTCGAGTACGCTTCTTTGAAGACGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004923.2-1371s1c1
Sequence:CCGGGCCCAGAACGAAAGACACTAACTCGAGTTAGTGTCTTTCGTTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004923.2-677s1c1
Sequence:CCGGGCAACTTTGCAGAATCTTCTTCTCGAGAAGAAGATTCTGCAAAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010841
MTL5 MISSION shRNA Bacterial Glycerol Stock
metallothionein-like 5, testis-specific (tesmin)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010841.1-1685s1c1
Sequence:CCGGGCCTACTCAAGGTATCCTAAACTCGAGTTTAGGATACCTTGAGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010841.1-1010s1c1
Sequence:CCGGCGAGCGCTTCAAAGCCATAAACTCGAGTTTATGGCTTTGAAGCGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010841.1-779s1c1
Sequence:CCGGCCCTAAGCCAATGACAACTTTCTCGAGAAAGTTGTCATTGGCTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010841.1-787s1c1
Sequence:CCGGCAATGACAACTTTAGTGGGAACTCGAGTTCCCACTAAAGTTGTCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010841.1-1499s1c1
Sequence:CCGGCCACATCGAGTTCAAGTCCAACTCGAGTTGGACTTGAACTCGATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010841
MTL5 MISSION shRNA shRNA Plasmid DNA
metallothionein-like 5, testis-specific (tesmin)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010841.1-1685s1c1
Sequence:CCGGGCCTACTCAAGGTATCCTAAACTCGAGTTTAGGATACCTTGAGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010841.1-1010s1c1
Sequence:CCGGCGAGCGCTTCAAAGCCATAAACTCGAGTTTATGGCTTTGAAGCGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010841.1-779s1c1
Sequence:CCGGCCCTAAGCCAATGACAACTTTCTCGAGAAAGTTGTCATTGGCTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010841.1-787s1c1
Sequence:CCGGCAATGACAACTTTAGTGGGAACTCGAGTTCCCACTAAAGTTGTCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010841.1-1499s1c1
Sequence:CCGGCCACATCGAGTTCAAGTCCAACTCGAGTTGGACTTGAACTCGATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010841
MTL5 MISSION shRNA Lentiviral Transduction Particles
metallothionein-like 5, testis-specific (tesmin)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010841.1-1685s1c1
Sequence:CCGGGCCTACTCAAGGTATCCTAAACTCGAGTTTAGGATACCTTGAGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010841.1-1010s1c1
Sequence:CCGGCGAGCGCTTCAAAGCCATAAACTCGAGTTTATGGCTTTGAAGCGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010841.1-779s1c1
Sequence:CCGGCCCTAAGCCAATGACAACTTTCTCGAGAAAGTTGTCATTGGCTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010841.1-787s1c1
Sequence:CCGGCAATGACAACTTTAGTGGGAACTCGAGTTCCCACTAAAGTTGTCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010841.1-1499s1c1
Sequence:CCGGCCACATCGAGTTCAAGTCCAACTCGAGTTGGACTTGAACTCGATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)