EMAIL THIS PAGE TO A FRIEND

MTM1

myotubularin 1

141 Gene Product Result for
Synonyms: CNM MTMX XLMTM
UniProtKB ID: Q13496, A6NDB1, Q8NEL1
Gene ID:
Human(4534) Summary: This gene encodes a dual-specificity phosphatase that acts on both phosphotyrosine and phosphoserine. It is required for muscle cell differentiation and mutations in this gene have been identified as being responsible for X-linked myotubular myopathy. [provided by RefSeq, Jul 2008]
Mouse(17772) X-linked myotubular myopathy gene 1
Rat(288762) myotubularin 1
Zebrafish(560881) myotubularin 1
dog(612385) myotubularin 1
Horse(100069680) myotubularin 1
cow(533622) myotubularin 1
domestic cat(101093757) myotubularin 1
Thale Cress(828907) manganese tracking factor for mitochondrial SOD2
chicken(422388) myotubularin 1
naked mole-rat(101698768) myotubularin 1
sheep(101114846) myotubularin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019926 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019926 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019926 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000252 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000252 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000252 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000252 siRNAs that have been validated in the lab human pricing
NM_001013047 Rosetta Predictions rat pricing
NM_019926 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000252 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025767 validated 908
1 SASI_Hs01_00025769 validated 1318
2 SASI_Hs01_00025768 predicted 1016
3 SASI_Hs01_00025770 predicted 845
4 SASI_Hs02_00302174 predicted 1650
5 SASI_Hs01_00025771 predicted 1269
6 SASI_Hs01_00025772 predicted 390
7 SASI_Hs01_00025773 predicted 1274
8 SASI_Hs01_00025774 predicted 862
9 SASI_Hs01_00025775 predicted 259
10 SASI_Hs01_00025776 predicted 1314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013047 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070767 predicted 243
2 SASI_Rn01_00070768 predicted 591
3 SASI_Rn01_00070769 predicted 678
4 SASI_Rn01_00070770 predicted 841
5 SASI_Rn01_00070771 predicted 303
6 SASI_Rn01_00070772 predicted 1694
7 SASI_Rn01_00070773 predicted 488
8 SASI_Rn01_00070774 predicted 470
9 SASI_Rn01_00070775 predicted 688
10 SASI_Rn01_00070776 predicted 535
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019926 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058128 predicted 295
2 SASI_Mm01_00058129 predicted 1312
3 SASI_Mm01_00058130 predicted 420
4 SASI_Mm01_00058132 predicted 1098
5 SASI_Mm01_00058133 predicted 393
6 SASI_Mm01_00058134 predicted 1013
7 SASI_Mm01_00058135 predicted 882
8 SASI_Mm02_00325206 predicted 565
9 SASI_Mm01_00058136 predicted 1329
10 SASI_Mm01_00058137 predicted 1565
11 SASI_Mm01_00058131 predicted 1562
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019926
VALIDATED
MTM1 MISSION shRNA Bacterial Glycerol Stock
myotubularin 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019926.1-2697s1c1
Sequence:CCGGCCTCTAGTCAATTCGCCTTATCTCGAGATAAGGCGAATTGACTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019926.2-1756s21c1
Sequence:CCGGTGGCCTTGCGTGACGATTATACTCGAGTATAATCGTCACGCAAGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019926.1-1319s1c1
Sequence:CCGGGCCATAAATTTGCATCTAGAACTCGAGTTCTAGATGCAAATTTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019926.1-1063s1c1
Sequence:CCGGCCCAACATAGAAGAATCTCATCTCGAGATGAGATTCTTCTATGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019926.1-508s1c1
Sequence:CCGGGCACACAATCTGCCATTATTTCTCGAGAAATAATGGCAGATTGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019926.1-1281s1c1
Sequence:CCGGCTTTGAGATATTGGTACAGAACTCGAGTTCTGTACCAATATCTCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019926.2-266s21c1
Sequence:CCGGCATCACAAATTATCGTCTTTACTCGAGTAAAGACGATAATTTGTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019926.3-114s21c1
Sequence:CCGGTTGGAGAATGAATCCATTAAGCTCGAGCTTAATGGATTCATTCTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019926.3-1757s21c1
Sequence:CCGGGGCCTTGCGTGACGATTATATCTCGAGATATAATCGTCACGCAAGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019926.2-1280s21c1
Sequence:CCGGCTTTGAGATATTGGTACAGAACTCGAGTTCTGTACCAATATCTCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019926.2-507s21c1
Sequence:CCGGGCACACAATCTGCCATTATTTCTCGAGAAATAATGGCAGATTGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019926.2-2696s21c1
Sequence:CCGGCCTCTAGTCAATTCGCCTTATCTCGAGATAAGGCGAATTGACTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019926.3-1665s21c1
Sequence:CCGGTTGGAACTGTGGGTGAATTATCTCGAGATAATTCACCCACAGTTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019926
VALIDATED
MTM1 MISSION shRNA shRNA Plasmid DNA
myotubularin 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019926.1-2697s1c1
Sequence:CCGGCCTCTAGTCAATTCGCCTTATCTCGAGATAAGGCGAATTGACTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019926.2-1756s21c1
Sequence:CCGGTGGCCTTGCGTGACGATTATACTCGAGTATAATCGTCACGCAAGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019926.1-1319s1c1
Sequence:CCGGGCCATAAATTTGCATCTAGAACTCGAGTTCTAGATGCAAATTTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019926.1-1063s1c1
Sequence:CCGGCCCAACATAGAAGAATCTCATCTCGAGATGAGATTCTTCTATGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019926.1-508s1c1
Sequence:CCGGGCACACAATCTGCCATTATTTCTCGAGAAATAATGGCAGATTGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019926.1-1281s1c1
Sequence:CCGGCTTTGAGATATTGGTACAGAACTCGAGTTCTGTACCAATATCTCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019926.2-266s21c1
Sequence:CCGGCATCACAAATTATCGTCTTTACTCGAGTAAAGACGATAATTTGTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019926.3-114s21c1
Sequence:CCGGTTGGAGAATGAATCCATTAAGCTCGAGCTTAATGGATTCATTCTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019926.3-1757s21c1
Sequence:CCGGGGCCTTGCGTGACGATTATATCTCGAGATATAATCGTCACGCAAGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019926.2-1280s21c1
Sequence:CCGGCTTTGAGATATTGGTACAGAACTCGAGTTCTGTACCAATATCTCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019926.2-507s21c1
Sequence:CCGGGCACACAATCTGCCATTATTTCTCGAGAAATAATGGCAGATTGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019926.2-2696s21c1
Sequence:CCGGCCTCTAGTCAATTCGCCTTATCTCGAGATAAGGCGAATTGACTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019926.3-1665s21c1
Sequence:CCGGTTGGAACTGTGGGTGAATTATCTCGAGATAATTCACCCACAGTTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019926
VALIDATED
MTM1 MISSION shRNA Lentiviral Transduction Particles
myotubularin 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019926.1-2697s1c1
Sequence:CCGGCCTCTAGTCAATTCGCCTTATCTCGAGATAAGGCGAATTGACTAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019926.2-1756s21c1
Sequence:CCGGTGGCCTTGCGTGACGATTATACTCGAGTATAATCGTCACGCAAGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019926.1-1319s1c1
Sequence:CCGGGCCATAAATTTGCATCTAGAACTCGAGTTCTAGATGCAAATTTATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019926.1-1063s1c1
Sequence:CCGGCCCAACATAGAAGAATCTCATCTCGAGATGAGATTCTTCTATGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019926.1-508s1c1
Sequence:CCGGGCACACAATCTGCCATTATTTCTCGAGAAATAATGGCAGATTGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019926.1-1281s1c1
Sequence:CCGGCTTTGAGATATTGGTACAGAACTCGAGTTCTGTACCAATATCTCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019926.2-266s21c1
Sequence:CCGGCATCACAAATTATCGTCTTTACTCGAGTAAAGACGATAATTTGTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019926.3-114s21c1
Sequence:CCGGTTGGAGAATGAATCCATTAAGCTCGAGCTTAATGGATTCATTCTCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019926.3-1757s21c1
Sequence:CCGGGGCCTTGCGTGACGATTATATCTCGAGATATAATCGTCACGCAAGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019926.2-1280s21c1
Sequence:CCGGCTTTGAGATATTGGTACAGAACTCGAGTTCTGTACCAATATCTCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019926.2-507s21c1
Sequence:CCGGGCACACAATCTGCCATTATTTCTCGAGAAATAATGGCAGATTGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019926.2-2696s21c1
Sequence:CCGGCCTCTAGTCAATTCGCCTTATCTCGAGATAAGGCGAATTGACTAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019926.3-1665s21c1
Sequence:CCGGTTGGAACTGTGGGTGAATTATCTCGAGATAATTCACCCACAGTTCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000252
VALIDATED
MTM1 MISSION shRNA Bacterial Glycerol Stock
myotubularin 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_000252.x-3180s1c1
Sequence:CCGGGACATCTCAAATACAGTAGTACTCGAGTACTACTGTATTTGAGATGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000252.x-1747s1c1
Sequence:CCGGGACGAATACATAAAGCGGCTTCTCGAGAAGCCGCTTTATGTATTCGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000252.x-795s1c1
Sequence:CCGGCGGTATGAGTGGGAAACGAAACTCGAGTTTCGTTTCCCACTCATACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_000252.x-1123s1c1
Sequence:CCGGGCCATTCAAGTAGCAGACAAACTCGAGTTTGTCTGCTACTTGAATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000252.2-1272s21c1
Sequence:CCGGGCATTGAAGGGTTCGAAATACCTCGAGGTATTTCGAACCCTTCAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355941    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_000252.2-1904s21c1
Sequence:CCGGCCGCATTAGAGCTCGAAATAACTCGAGTTATTTCGAGCTCTAATGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000252.2-820s21c1
Sequence:CCGGTATGAGTGGGAAACGAAATAACTCGAGTTATTTCGTTTCCCACTCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_000252.2-862s21c1
Sequence:CCGGTGTTATCAGGGAGACTAATAACTCGAGTTATTAGTCTCCCTGATAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000252.2-268s21c1
Sequence:CCGGCATCACAAATTATCGTCTTTACTCGAGTAAAGACGATAATTTGTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000252
VALIDATED
MTM1 MISSION shRNA shRNA Plasmid DNA
myotubularin 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_000252.x-3180s1c1
Sequence:CCGGGACATCTCAAATACAGTAGTACTCGAGTACTACTGTATTTGAGATGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000252.x-1747s1c1
Sequence:CCGGGACGAATACATAAAGCGGCTTCTCGAGAAGCCGCTTTATGTATTCGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000252.x-795s1c1
Sequence:CCGGCGGTATGAGTGGGAAACGAAACTCGAGTTTCGTTTCCCACTCATACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_000252.x-1123s1c1
Sequence:CCGGGCCATTCAAGTAGCAGACAAACTCGAGTTTGTCTGCTACTTGAATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000252.2-1272s21c1
Sequence:CCGGGCATTGAAGGGTTCGAAATACCTCGAGGTATTTCGAACCCTTCAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355941    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_000252.2-1904s21c1
Sequence:CCGGCCGCATTAGAGCTCGAAATAACTCGAGTTATTTCGAGCTCTAATGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000252.2-820s21c1
Sequence:CCGGTATGAGTGGGAAACGAAATAACTCGAGTTATTTCGTTTCCCACTCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_000252.2-862s21c1
Sequence:CCGGTGTTATCAGGGAGACTAATAACTCGAGTTATTAGTCTCCCTGATAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000252.2-268s21c1
Sequence:CCGGCATCACAAATTATCGTCTTTACTCGAGTAAAGACGATAATTTGTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000252
VALIDATED
MTM1 MISSION shRNA Lentiviral Transduction Particles
myotubularin 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_000252.x-3180s1c1
Sequence:CCGGGACATCTCAAATACAGTAGTACTCGAGTACTACTGTATTTGAGATGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000252.x-1747s1c1
Sequence:CCGGGACGAATACATAAAGCGGCTTCTCGAGAAGCCGCTTTATGTATTCGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000252.x-795s1c1
Sequence:CCGGCGGTATGAGTGGGAAACGAAACTCGAGTTTCGTTTCCCACTCATACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_000252.x-1123s1c1
Sequence:CCGGGCCATTCAAGTAGCAGACAAACTCGAGTTTGTCTGCTACTTGAATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000252.2-1272s21c1
Sequence:CCGGGCATTGAAGGGTTCGAAATACCTCGAGGTATTTCGAACCCTTCAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355941    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_000252.2-1904s21c1
Sequence:CCGGCCGCATTAGAGCTCGAAATAACTCGAGTTATTTCGAGCTCTAATGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000252.2-820s21c1
Sequence:CCGGTATGAGTGGGAAACGAAATAACTCGAGTTATTTCGTTTCCCACTCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_000252.2-862s21c1
Sequence:CCGGTGTTATCAGGGAGACTAATAACTCGAGTTATTAGTCTCCCTGATAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000252.2-268s21c1
Sequence:CCGGCATCACAAATTATCGTCTTTACTCGAGTAAAGACGATAATTTGTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)