EMAIL THIS PAGE TO A FRIEND

MTMR11

myotubularin related protein 11

74 Gene Product Result for
Synonyms: CRA RP11-212K13.1
Gene ID:
Mouse(194126) myotubularin related protein 11
Rat(689613) myotubularin related protein 11
sheep(101102103) myotubularin related protein 11
naked mole-rat(101713140) myotubularin related protein 11
domestic guinea pig(100718905) myotubularin related protein 11
cow(506122) myotubularin related protein 11
dog(608700) myotubularin related protein 11
domestic cat(101088945) myotubularin related protein 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA030351 Anti-MTMR11 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181873 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181873 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181873 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181409 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181409 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181409 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006697 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006697 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006697 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181873 Rosetta Predictions human pricing
XM_001069837 Rosetta Predictions rat pricing
NM_181409 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181873 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191814 predicted 1033
2 SASI_Hs01_00191815 predicted 855
3 SASI_Hs01_00191816 predicted 2043
4 SASI_Hs01_00191817 predicted 241
5 SASI_Hs01_00191818 predicted 1974
6 SASI_Hs01_00191819 predicted 654
7 SASI_Hs01_00191820 predicted 1028
8 SASI_Hs01_00191821 predicted 353
9 SASI_Hs01_00191822 predicted 2086
10 SASI_Hs01_00191823 predicted 1535
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069837 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00329507 predicted 527
2 SASI_Rn02_00329508 predicted 1793
3 SASI_Rn02_00329509 predicted 1107
4 SASI_Rn02_00329510 predicted 879
5 SASI_Rn02_00329511 predicted 1066
6 SASI_Rn02_00329512 predicted 417
7 SASI_Rn02_00329513 predicted 1659
8 SASI_Rn02_00329514 predicted 471
9 SASI_Rn02_00329515 predicted 1160
10 SASI_Rn02_00329516 predicted 2394
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181409 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151302 predicted 1057
2 SASI_Mm01_00151303 predicted 386
3 SASI_Mm01_00151304 predicted 1521
4 SASI_Mm01_00151305 predicted 1115
5 SASI_Mm01_00151306 predicted 839
6 SASI_Mm01_00151307 predicted 757
7 SASI_Mm01_00151308 predicted 2238
8 SASI_Mm01_00151309 predicted 1503
9 SASI_Mm01_00151310 predicted 2176
10 SASI_Mm02_00349757 predicted 837
11 SASI_Mm01_00151311 predicted 2345
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181873
VALIDATED
MTMR11 MISSION shRNA Bacterial Glycerol Stock
myotubularin related protein 11
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000303459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_181873.3-802s21c1
Sequence:CCGGTCCGCTGTGGAGGCTTCTATACTCGAGTATAGAAGCCTCCACAGCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181873.3-2163s21c1
Sequence:CCGGCCCAACAAGATGGCCTAGAAACTCGAGTTTCTAGGCCATCTTGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181873.3-1450s21c1
Sequence:CCGGGCGGACAGTTAAACTCCTATACTCGAGTATAGGAGTTTAACTGTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_181873.1-267s1c1
Sequence:CCGGCCTGGTCAACATTGGACGATTCTCGAGAATCGTCCAATGTTGACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181873.3-1554s21c1
Sequence:CCGGCGTTATAGCAATGCACAGATACTCGAGTATCTGTGCATTGCTATAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_181873.3-1062s21c1
Sequence:CCGGGCCAGTGACATTTCAGTATTACTCGAGTAATACTGAAATGTCACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113766    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_181873.1-2140s1c1
Sequence:CCGGCCCAACAAGATGGCCTAGAAACTCGAGTTTCTAGGCCATCTTGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181873.1-1427s1c1
Sequence:CCGGGCGGACAGTTAAACTCCTATACTCGAGTATAGGAGTTTAACTGTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_181873.1-1039s1c1
Sequence:CCGGGCCAGTGACATTTCAGTATTACTCGAGTAATACTGAAATGTCACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_181873.1-1531s1c1
Sequence:CCGGCGTTATAGCAATGCACAGATACTCGAGTATCTGTGCATTGCTATAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181873
VALIDATED
MTMR11 MISSION shRNA shRNA Plasmid DNA
myotubularin related protein 11
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000303459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_181873.3-802s21c1
Sequence:CCGGTCCGCTGTGGAGGCTTCTATACTCGAGTATAGAAGCCTCCACAGCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181873.3-2163s21c1
Sequence:CCGGCCCAACAAGATGGCCTAGAAACTCGAGTTTCTAGGCCATCTTGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181873.3-1450s21c1
Sequence:CCGGGCGGACAGTTAAACTCCTATACTCGAGTATAGGAGTTTAACTGTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_181873.1-267s1c1
Sequence:CCGGCCTGGTCAACATTGGACGATTCTCGAGAATCGTCCAATGTTGACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181873.3-1554s21c1
Sequence:CCGGCGTTATAGCAATGCACAGATACTCGAGTATCTGTGCATTGCTATAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_181873.3-1062s21c1
Sequence:CCGGGCCAGTGACATTTCAGTATTACTCGAGTAATACTGAAATGTCACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113766    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_181873.1-2140s1c1
Sequence:CCGGCCCAACAAGATGGCCTAGAAACTCGAGTTTCTAGGCCATCTTGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181873.1-1427s1c1
Sequence:CCGGGCGGACAGTTAAACTCCTATACTCGAGTATAGGAGTTTAACTGTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_181873.1-1039s1c1
Sequence:CCGGGCCAGTGACATTTCAGTATTACTCGAGTAATACTGAAATGTCACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_181873.1-1531s1c1
Sequence:CCGGCGTTATAGCAATGCACAGATACTCGAGTATCTGTGCATTGCTATAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181873
VALIDATED
MTMR11 MISSION shRNA Lentiviral Transduction Particles
myotubularin related protein 11
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000303459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_181873.3-802s21c1
Sequence:CCGGTCCGCTGTGGAGGCTTCTATACTCGAGTATAGAAGCCTCCACAGCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181873.3-2163s21c1
Sequence:CCGGCCCAACAAGATGGCCTAGAAACTCGAGTTTCTAGGCCATCTTGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181873.3-1450s21c1
Sequence:CCGGGCGGACAGTTAAACTCCTATACTCGAGTATAGGAGTTTAACTGTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_181873.1-267s1c1
Sequence:CCGGCCTGGTCAACATTGGACGATTCTCGAGAATCGTCCAATGTTGACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181873.3-1554s21c1
Sequence:CCGGCGTTATAGCAATGCACAGATACTCGAGTATCTGTGCATTGCTATAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_181873.3-1062s21c1
Sequence:CCGGGCCAGTGACATTTCAGTATTACTCGAGTAATACTGAAATGTCACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113766    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_181873.1-2140s1c1
Sequence:CCGGCCCAACAAGATGGCCTAGAAACTCGAGTTTCTAGGCCATCTTGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181873.1-1427s1c1
Sequence:CCGGGCGGACAGTTAAACTCCTATACTCGAGTATAGGAGTTTAACTGTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_181873.1-1039s1c1
Sequence:CCGGGCCAGTGACATTTCAGTATTACTCGAGTAATACTGAAATGTCACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_181873.1-1531s1c1
Sequence:CCGGCGTTATAGCAATGCACAGATACTCGAGTATCTGTGCATTGCTATAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181409
VALIDATED
MTMR11 MISSION shRNA Bacterial Glycerol Stock
myotubularin related protein 11
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181409.2-386s1c1
Sequence:CCGGGCACTAACTTTAGGGTAACCTCTCGAGAGGTTACCCTAAAGTTAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181409.2-1842s1c1
Sequence:CCGGCCCTAGTTCTATGTGGCTGTTCTCGAGAACAGCCACATAGAACTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181409.2-1244s1c1
Sequence:CCGGGCGACATCTCAGTATTAGTGACTCGAGTCACTAATACTGAGATGTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181409.2-387s1c1
Sequence:CCGGCACTAACTTTAGGGTAACCTTCTCGAGAAGGTTACCCTAAAGTTAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181409.2-1549s1c1
Sequence:CCGGCTTGCTCTTCATGATAGTATCCTCGAGGATACTATCATGAAGAGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181409.2-2180s1c1
Sequence:CCGGGACAATGGACACCAAGAATATCTCGAGATATTCTTGGTGTCCATTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181409
VALIDATED
MTMR11 MISSION shRNA shRNA Plasmid DNA
myotubularin related protein 11
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181409.2-386s1c1
Sequence:CCGGGCACTAACTTTAGGGTAACCTCTCGAGAGGTTACCCTAAAGTTAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181409.2-1842s1c1
Sequence:CCGGCCCTAGTTCTATGTGGCTGTTCTCGAGAACAGCCACATAGAACTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181409.2-1244s1c1
Sequence:CCGGGCGACATCTCAGTATTAGTGACTCGAGTCACTAATACTGAGATGTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181409.2-387s1c1
Sequence:CCGGCACTAACTTTAGGGTAACCTTCTCGAGAAGGTTACCCTAAAGTTAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181409.2-1549s1c1
Sequence:CCGGCTTGCTCTTCATGATAGTATCCTCGAGGATACTATCATGAAGAGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181409.2-2180s1c1
Sequence:CCGGGACAATGGACACCAAGAATATCTCGAGATATTCTTGGTGTCCATTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181409
VALIDATED
MTMR11 MISSION shRNA Lentiviral Transduction Particles
myotubularin related protein 11
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181409.2-386s1c1
Sequence:CCGGGCACTAACTTTAGGGTAACCTCTCGAGAGGTTACCCTAAAGTTAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181409.2-1842s1c1
Sequence:CCGGCCCTAGTTCTATGTGGCTGTTCTCGAGAACAGCCACATAGAACTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181409.2-1244s1c1
Sequence:CCGGGCGACATCTCAGTATTAGTGACTCGAGTCACTAATACTGAGATGTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181409.2-387s1c1
Sequence:CCGGCACTAACTTTAGGGTAACCTTCTCGAGAAGGTTACCCTAAAGTTAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181409.2-1549s1c1
Sequence:CCGGCTTGCTCTTCATGATAGTATCCTCGAGGATACTATCATGAAGAGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181409.2-2180s1c1
Sequence:CCGGGACAATGGACACCAAGAATATCTCGAGATATTCTTGGTGTCCATTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006697
MTMR11 MISSION shRNA Bacterial Glycerol Stock
myotubularin related protein 11
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000122879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006697.1-687s1c1
Sequence:CCGGGAGCAATCAAGCCCAACAGTACTCGAGTACTGTTGGGCTTGATTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006697
MTMR11 MISSION shRNA shRNA Plasmid DNA
myotubularin related protein 11
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000122879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006697.1-687s1c1
Sequence:CCGGGAGCAATCAAGCCCAACAGTACTCGAGTACTGTTGGGCTTGATTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006697
MTMR11 MISSION shRNA Lentiviral Transduction Particles
myotubularin related protein 11
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000122879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006697.1-687s1c1
Sequence:CCGGGAGCAATCAAGCCCAACAGTACTCGAGTACTGTTGGGCTTGATTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)