EMAIL THIS PAGE TO A FRIEND

MTMR14

myotubularin related protein 14

134 Gene Product Result for
Synonyms: C3orf29
Gene ID:
Human(64419) Summary: This gene encodes a myotubularin-related protein. The encoded protein is a phosphoinositide phosphatase that specifically dephosphorylates phosphatidylinositol 3,5-biphosphate and phosphatidylinositol 3-phosphate. Mutations in this gene are correlated with autosomal dominant centronuclear myopathy. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 18.[provided by RefSeq, Apr 2010]
Mouse(97287) myotubularin related protein 14
Rat(312634) myotubularin related protein 14
sheep(101102342) myotubularin related protein 14
naked mole-rat(101724817) myotubularin related protein 14
Domestic Rabbit(100348191) myotubularin related protein 14
domestic guinea pig(100731708) myotubularin related protein 14
Zebrafish(323929) myotubularin related protein 14
cow(514596) myotubularin related protein 14
domestic cat(101083154) myotubularin related protein 14
dog(484668) myotubularin related protein 14
chicken(416048) myotubularin related protein 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026849 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026849 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026849 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022485 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022485 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022485 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077525 Rosetta Predictions human pricing
NM_001077526 Rosetta Predictions human pricing
NM_022485 Rosetta Predictions human pricing
NM_001107880 Rosetta Predictions rat pricing
NM_026849 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077525 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312944 predicted 313
2 SASI_Hs02_00312945 predicted 536
3 SASI_Hs02_00312946 predicted 274
4 SASI_Hs02_00312947 predicted 1314
5 SASI_Hs02_00312948 predicted 428
6 SASI_Hs02_00312949 predicted 317
7 SASI_Hs02_00312950 predicted 729
8 SASI_Hs02_00312951 predicted 297
9 SASI_Hs02_00312952 predicted 735
10 SASI_Hs02_00312953 predicted 1224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077526 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312954 predicted 304
2 SASI_Hs02_00312955 predicted 532
3 SASI_Hs02_00312956 predicted 275
4 SASI_Hs02_00312957 predicted 1314
5 SASI_Hs02_00312958 predicted 428
6 SASI_Hs02_00312959 predicted 316
7 SASI_Hs02_00312960 predicted 729
8 SASI_Hs02_00312961 predicted 295
9 SASI_Hs02_00312962 predicted 740
10 SASI_Hs02_00312963 predicted 1224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022485 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355770 predicted 304
2 SASI_Hs01_00191489 predicted 539
3 SASI_Hs02_00355771 predicted 275
4 SASI_Hs01_00191492 predicted 1310
5 SASI_Hs02_00355772 predicted 428
6 SASI_Hs02_00355773 predicted 320
7 SASI_Hs02_00355774 predicted 724
8 SASI_Hs02_00355775 predicted 300
9 SASI_Hs02_00355776 predicted 739
10 SASI_Hs02_00355777 predicted 1224
11 SASI_Hs01_00191486 predicted 1672
12 SASI_Hs01_00191487 predicted 913
13 SASI_Hs01_00191488 predicted 598
14 SASI_Hs01_00191490 predicted 857
15 SASI_Hs01_00191491 predicted 794
16 SASI_Hs01_00191493 predicted 1159
17 SASI_Hs01_00191494 predicted 1721
18 SASI_Hs01_00191495 predicted 435
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107880 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233185 predicted 505
2 SASI_Rn02_00233186 predicted 307
3 SASI_Rn02_00233187 predicted 383
4 SASI_Rn02_00233188 predicted 1214
5 SASI_Rn02_00233189 predicted 301
6 SASI_Rn02_00233190 predicted 1485
7 SASI_Rn02_00233191 predicted 406
8 SASI_Rn02_00233192 predicted 1759
9 SASI_Rn02_00233193 predicted 650
10 SASI_Rn02_00233194 predicted 525
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026849 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151255 predicted 653
2 SASI_Mm02_00331050 predicted 318
3 SASI_Mm01_00151252 predicted 1223
4 SASI_Mm01_00151253 predicted 982
5 SASI_Mm02_00331051 predicted 265
6 SASI_Mm02_00331052 predicted 303
7 SASI_Mm01_00151256 predicted 617
8 SASI_Mm01_00151257 predicted 1383
9 SASI_Mm01_00151258 predicted 1493
10 SASI_Mm01_00151259 predicted 528
11 SASI_Mm01_00151254 predicted 1734
12 SASI_Mm01_00151260 predicted 1090
13 SASI_Mm01_00151261 predicted 539
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026849
VALIDATED
MTMR14 MISSION shRNA Bacterial Glycerol Stock
myotubularin related protein 14
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026849.2-1163s21c1
Sequence:CCGGTGTGGGCTGATGGGCTAATTCCTCGAGGAATTAGCCCATCAGCCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026849.2-588s21c1
Sequence:CCGGCTCGGGATACAACTATTTATTCTCGAGAATAAATAGTTGTATCCCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026849.2-699s21c1
Sequence:CCGGTAAGGTGAGAGGCTATGATATCTCGAGATATCATAGCCTCTCACCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026849.1-928s1c1
Sequence:CCGGCCTGACTCAATCTCTGAACATCTCGAGATGTTCAGAGATTGAGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026849.2-2436s21c1
Sequence:CCGGATGAGGCAATTTCACACTAATCTCGAGATTAGTGTGAAATTGCCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026849.2-978s21c1
Sequence:CCGGCCTGACTCAATCTCTGAACATCTCGAGATGTTCAGAGATTGAGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026849.1-2302s1c1
Sequence:CCGGCAGGGCCTCATGGAGATTATACTCGAGTATAATCTCCATGAGGCCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026849.1-536s1c1
Sequence:CCGGCGCTCGGGATACAACTATTTACTCGAGTAAATAGTTGTATCCCGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026849.1-471s1c1
Sequence:CCGGTCCTGTTCAAAGGCAAGCATACTCGAGTATGCTTGCCTTTGAACAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026849.1-538s1c1
Sequence:CCGGCTCGGGATACAACTATTTATTCTCGAGAATAAATAGTTGTATCCCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026849
VALIDATED
MTMR14 MISSION shRNA shRNA Plasmid DNA
myotubularin related protein 14
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026849.2-1163s21c1
Sequence:CCGGTGTGGGCTGATGGGCTAATTCCTCGAGGAATTAGCCCATCAGCCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026849.2-588s21c1
Sequence:CCGGCTCGGGATACAACTATTTATTCTCGAGAATAAATAGTTGTATCCCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026849.2-699s21c1
Sequence:CCGGTAAGGTGAGAGGCTATGATATCTCGAGATATCATAGCCTCTCACCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026849.1-928s1c1
Sequence:CCGGCCTGACTCAATCTCTGAACATCTCGAGATGTTCAGAGATTGAGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026849.2-2436s21c1
Sequence:CCGGATGAGGCAATTTCACACTAATCTCGAGATTAGTGTGAAATTGCCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026849.2-978s21c1
Sequence:CCGGCCTGACTCAATCTCTGAACATCTCGAGATGTTCAGAGATTGAGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026849.1-2302s1c1
Sequence:CCGGCAGGGCCTCATGGAGATTATACTCGAGTATAATCTCCATGAGGCCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026849.1-536s1c1
Sequence:CCGGCGCTCGGGATACAACTATTTACTCGAGTAAATAGTTGTATCCCGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026849.1-471s1c1
Sequence:CCGGTCCTGTTCAAAGGCAAGCATACTCGAGTATGCTTGCCTTTGAACAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026849.1-538s1c1
Sequence:CCGGCTCGGGATACAACTATTTATTCTCGAGAATAAATAGTTGTATCCCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026849
VALIDATED
MTMR14 MISSION shRNA Lentiviral Transduction Particles
myotubularin related protein 14
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026849.2-1163s21c1
Sequence:CCGGTGTGGGCTGATGGGCTAATTCCTCGAGGAATTAGCCCATCAGCCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026849.2-588s21c1
Sequence:CCGGCTCGGGATACAACTATTTATTCTCGAGAATAAATAGTTGTATCCCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026849.2-699s21c1
Sequence:CCGGTAAGGTGAGAGGCTATGATATCTCGAGATATCATAGCCTCTCACCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026849.1-928s1c1
Sequence:CCGGCCTGACTCAATCTCTGAACATCTCGAGATGTTCAGAGATTGAGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026849.2-2436s21c1
Sequence:CCGGATGAGGCAATTTCACACTAATCTCGAGATTAGTGTGAAATTGCCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026849.2-978s21c1
Sequence:CCGGCCTGACTCAATCTCTGAACATCTCGAGATGTTCAGAGATTGAGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026849.1-2302s1c1
Sequence:CCGGCAGGGCCTCATGGAGATTATACTCGAGTATAATCTCCATGAGGCCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026849.1-536s1c1
Sequence:CCGGCGCTCGGGATACAACTATTTACTCGAGTAAATAGTTGTATCCCGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026849.1-471s1c1
Sequence:CCGGTCCTGTTCAAAGGCAAGCATACTCGAGTATGCTTGCCTTTGAACAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026849.1-538s1c1
Sequence:CCGGCTCGGGATACAACTATTTATTCTCGAGAATAAATAGTTGTATCCCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022485
VALIDATED
MTMR14 MISSION shRNA Bacterial Glycerol Stock
myotubularin related protein 14
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000272864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_022485.3-327s21c1
Sequence:CCGGACTACTGTTTCAGCGTGATTCCTCGAGGAATCACGCTGAAACAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_022485.3-938s21c1
Sequence:CCGGTGGAAGCAGGACTACGTTGATCTCGAGATCAACGTAGTCCTGCTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_022485.3-732s21c1
Sequence:CCGGTTCGATACCTGTCAGTCAAATCTCGAGATTTGACTGACAGGTATCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_022485.3-1024s21c1
Sequence:GTACCGGTTGGGATCTGGTGCAACAAACCTCGAGGTTTGTTGCACCAGATCCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022485.3-506s21c1
Sequence:CCGGCGGTTTGTCTGCCCAGTAATCCTCGAGGATTACTGGGCAGACAAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_022485.3-1742s21c1
Sequence:CCGGAGAAGCCAGCCCATGACATTTCTCGAGAAATGTCATGGGCTGGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022485.x-776s1c1
Sequence:CCGGCGACTTCACTCTCCTCTCCATCTCGAGATGGAGAGGAGAGTGAAGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381217    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_022485.3-1784s21c1
Sequence:GTACCGGGCCCTTAGCAGAGAATCAAAGCTCGAGCTTTGATTCTCTGCTAAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_022485.x-870s1c1
Sequence:CCGGTGGAAGCAGGACTACGTTGATCTCGAGATCAACGTAGTCCTGCTTCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022485.x-821s1c1
Sequence:CCGGCAAGGAATATAAAGATCGGGACTCGAGTCCCGATCTTTATATTCCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022485.x-1247s1c1
Sequence:CCGGGAAGCATATTACCTCCGAGGACTCGAGTCCTCGGAGGTAATATGCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022485
VALIDATED
MTMR14 MISSION shRNA shRNA Plasmid DNA
myotubularin related protein 14
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000272864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_022485.3-327s21c1
Sequence:CCGGACTACTGTTTCAGCGTGATTCCTCGAGGAATCACGCTGAAACAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_022485.3-938s21c1
Sequence:CCGGTGGAAGCAGGACTACGTTGATCTCGAGATCAACGTAGTCCTGCTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_022485.3-732s21c1
Sequence:CCGGTTCGATACCTGTCAGTCAAATCTCGAGATTTGACTGACAGGTATCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_022485.3-1024s21c1
Sequence:GTACCGGTTGGGATCTGGTGCAACAAACCTCGAGGTTTGTTGCACCAGATCCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022485.3-506s21c1
Sequence:CCGGCGGTTTGTCTGCCCAGTAATCCTCGAGGATTACTGGGCAGACAAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_022485.3-1742s21c1
Sequence:CCGGAGAAGCCAGCCCATGACATTTCTCGAGAAATGTCATGGGCTGGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022485.x-776s1c1
Sequence:CCGGCGACTTCACTCTCCTCTCCATCTCGAGATGGAGAGGAGAGTGAAGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381217    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_022485.3-1784s21c1
Sequence:GTACCGGGCCCTTAGCAGAGAATCAAAGCTCGAGCTTTGATTCTCTGCTAAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_022485.x-870s1c1
Sequence:CCGGTGGAAGCAGGACTACGTTGATCTCGAGATCAACGTAGTCCTGCTTCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022485.x-821s1c1
Sequence:CCGGCAAGGAATATAAAGATCGGGACTCGAGTCCCGATCTTTATATTCCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022485.x-1247s1c1
Sequence:CCGGGAAGCATATTACCTCCGAGGACTCGAGTCCTCGGAGGTAATATGCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022485
VALIDATED
MTMR14 MISSION shRNA Lentiviral Transduction Particles
myotubularin related protein 14
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000272864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_022485.3-327s21c1
Sequence:CCGGACTACTGTTTCAGCGTGATTCCTCGAGGAATCACGCTGAAACAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_022485.3-938s21c1
Sequence:CCGGTGGAAGCAGGACTACGTTGATCTCGAGATCAACGTAGTCCTGCTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_022485.3-732s21c1
Sequence:CCGGTTCGATACCTGTCAGTCAAATCTCGAGATTTGACTGACAGGTATCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_022485.3-1024s21c1
Sequence:GTACCGGTTGGGATCTGGTGCAACAAACCTCGAGGTTTGTTGCACCAGATCCCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022485.3-506s21c1
Sequence:CCGGCGGTTTGTCTGCCCAGTAATCCTCGAGGATTACTGGGCAGACAAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_022485.3-1742s21c1
Sequence:CCGGAGAAGCCAGCCCATGACATTTCTCGAGAAATGTCATGGGCTGGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022485.x-776s1c1
Sequence:CCGGCGACTTCACTCTCCTCTCCATCTCGAGATGGAGAGGAGAGTGAAGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381217    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_022485.3-1784s21c1
Sequence:GTACCGGGCCCTTAGCAGAGAATCAAAGCTCGAGCTTTGATTCTCTGCTAAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_022485.x-870s1c1
Sequence:CCGGTGGAAGCAGGACTACGTTGATCTCGAGATCAACGTAGTCCTGCTTCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022485.x-821s1c1
Sequence:CCGGCAAGGAATATAAAGATCGGGACTCGAGTCCCGATCTTTATATTCCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022485.x-1247s1c1
Sequence:CCGGGAAGCATATTACCTCCGAGGACTCGAGTCCTCGGAGGTAATATGCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)