EMAIL THIS PAGE TO A FRIEND

MTMR1

myotubularin related protein 1

97 Gene Product Result for
UniProtKB ID: Q13613, Q9UBX6, Q9UEM0, Q9UQD5
Gene ID:
Human(8776) Summary: This gene encodes a member of the myotubularin related family of proteins. Members of this family contain the consensus sequence for the active site of protein tyrosine phosphatases. Alternatively spliced variants have been described but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(53332) myotubularin related protein 1
Rat(317296) myotubularin related protein 1
sheep(101107677) myotubularin related protein 1
naked mole-rat(101699372) myotubularin related protein 1
domestic guinea pig(100725517) myotubularin related protein 1
chicken(422387) myotubularin related protein 1
cow(541155) myotubularin related protein 1
domestic cat(101098208) myotubularin related protein 1
dog(492211) myotubularin related protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003828 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003828 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003828 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016985 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016985 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016985 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU042901 MISSION® esiRNA esiRNA targeting mouse Mtmr1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003828 siRNAs that have been validated in the lab human pricing
XM_001059230 Rosetta Predictions rat pricing
XM_228644 Rosetta Predictions rat pricing
NM_016985 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003828 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129067 validated 1470
1 SASI_Hs01_00129066 validated 668
1 SASI_Hs01_00129068 validated 630
2 SASI_Hs02_00336382 predicted 1189
3 SASI_Hs01_00129069 predicted 768
4 SASI_Hs01_00129071 predicted 1686
5 SASI_Hs01_00129072 predicted 1522
6 SASI_Hs01_00129073 predicted 1802
7 SASI_Hs01_00129075 predicted 1294
8 SASI_Hs02_00336383 predicted 1056
9 SASI_Hs01_00129070 predicted 1965
10 SASI_Hs01_00129074 predicted 1219
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059230 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292524 predicted 402
2 SASI_Rn02_00292525 predicted 1092
3 SASI_Rn02_00292526 predicted 893
4 SASI_Rn02_00292527 predicted 350
5 SASI_Rn02_00292528 predicted 1643
6 SASI_Rn02_00292529 predicted 512
7 SASI_Rn02_00292530 predicted 842
8 SASI_Rn02_00292531 predicted 754
9 SASI_Rn02_00292532 predicted 1579
10 SASI_Rn02_00292533 predicted 1655
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228644 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385357 predicted 397
2 SASI_Rn02_00385358 predicted 1088
3 SASI_Rn02_00385359 predicted 896
4 SASI_Rn02_00385360 predicted 350
5 SASI_Rn02_00385361 predicted 1645
6 SASI_Rn02_00385362 predicted 519
7 SASI_Rn02_00385363 predicted 844
8 SASI_Rn02_00385364 predicted 761
9 SASI_Rn02_00385365 predicted 1586
10 SASI_Rn02_00385366 predicted 1657
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016985 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165473 predicted 1556
2 SASI_Mm01_00165474 predicted 1055
3 SASI_Mm01_00165475 predicted 1843
4 SASI_Mm01_00165476 predicted 1249
5 SASI_Mm01_00165478 predicted 313
6 SASI_Mm01_00165479 predicted 1263
7 SASI_Mm01_00165480 predicted 2002
8 SASI_Mm01_00165482 predicted 348
9 SASI_Mm02_00323842 predicted 968
10 SASI_Mm02_00323843 predicted 1151
11 SASI_Mm01_00165477 predicted 1165
12 SASI_Mm01_00165481 predicted 1135
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003828
VALIDATED
MTMR1 MISSION shRNA Bacterial Glycerol Stock
myotubularin related protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003828.2-512s21c1
Sequence:GTACCGGCCCTGACAGTGACGGACTTTACTCGAGTAAAGTCCGTCACTGTCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_003828.2-1275s21c1
Sequence:CCGGGCGAGAGTCACTACGCAAATTCTCGAGAATTTGCGTAGTGACTCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_003828.2-1780s21c1
Sequence:CCGGCGATTCAAAGAGGATGTATATCTCGAGATATACATCCTCTTTGAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003828.2-1176s21c1
Sequence:CCGGCGCTGATACCAACAAGACAAACTCGAGTTTGTCTTGTTGGTATCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_003828.2-2156s21c1
Sequence:CCGGCTGGCTGACTAGGACTGTTAACTCGAGTTAACAGTCCTAGTCAGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003828.x-1051s1c1
Sequence:CCGGCGGAAAGTCAAGCAACGATTACTCGAGTAATCGTTGCTTGACTTTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003828.x-1205s1c1
Sequence:CCGGCGCTGATACCAACAAGACAAACTCGAGTTTGTCTTGTTGGTATCAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003828.x-1809s1c1
Sequence:CCGGCGATTCAAAGAGGATGTATATCTCGAGATATACATCCTCTTTGAATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002986    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003828.x-2185s1c1
Sequence:CCGGCTGGCTGACTAGGACTGTTAACTCGAGTTAACAGTCCTAGTCAGCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003828.x-413s1c1
Sequence:CCGGCAAGGCTCTAAGGGATGGAAACTCGAGTTTCCATCCCTTAGAGCCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003828
VALIDATED
MTMR1 MISSION shRNA shRNA Plasmid DNA
myotubularin related protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003828.2-512s21c1
Sequence:GTACCGGCCCTGACAGTGACGGACTTTACTCGAGTAAAGTCCGTCACTGTCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_003828.2-1275s21c1
Sequence:CCGGGCGAGAGTCACTACGCAAATTCTCGAGAATTTGCGTAGTGACTCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_003828.2-1780s21c1
Sequence:CCGGCGATTCAAAGAGGATGTATATCTCGAGATATACATCCTCTTTGAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003828.2-1176s21c1
Sequence:CCGGCGCTGATACCAACAAGACAAACTCGAGTTTGTCTTGTTGGTATCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_003828.2-2156s21c1
Sequence:CCGGCTGGCTGACTAGGACTGTTAACTCGAGTTAACAGTCCTAGTCAGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003828.x-1051s1c1
Sequence:CCGGCGGAAAGTCAAGCAACGATTACTCGAGTAATCGTTGCTTGACTTTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003828.x-1205s1c1
Sequence:CCGGCGCTGATACCAACAAGACAAACTCGAGTTTGTCTTGTTGGTATCAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003828.x-1809s1c1
Sequence:CCGGCGATTCAAAGAGGATGTATATCTCGAGATATACATCCTCTTTGAATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002986    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003828.x-2185s1c1
Sequence:CCGGCTGGCTGACTAGGACTGTTAACTCGAGTTAACAGTCCTAGTCAGCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003828.x-413s1c1
Sequence:CCGGCAAGGCTCTAAGGGATGGAAACTCGAGTTTCCATCCCTTAGAGCCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003828
VALIDATED
MTMR1 MISSION shRNA Lentiviral Transduction Particles
myotubularin related protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003828.2-512s21c1
Sequence:GTACCGGCCCTGACAGTGACGGACTTTACTCGAGTAAAGTCCGTCACTGTCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_003828.2-1275s21c1
Sequence:CCGGGCGAGAGTCACTACGCAAATTCTCGAGAATTTGCGTAGTGACTCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_003828.2-1780s21c1
Sequence:CCGGCGATTCAAAGAGGATGTATATCTCGAGATATACATCCTCTTTGAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003828.2-1176s21c1
Sequence:CCGGCGCTGATACCAACAAGACAAACTCGAGTTTGTCTTGTTGGTATCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_003828.2-2156s21c1
Sequence:CCGGCTGGCTGACTAGGACTGTTAACTCGAGTTAACAGTCCTAGTCAGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003828.x-1051s1c1
Sequence:CCGGCGGAAAGTCAAGCAACGATTACTCGAGTAATCGTTGCTTGACTTTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003828.x-1205s1c1
Sequence:CCGGCGCTGATACCAACAAGACAAACTCGAGTTTGTCTTGTTGGTATCAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003828.x-1809s1c1
Sequence:CCGGCGATTCAAAGAGGATGTATATCTCGAGATATACATCCTCTTTGAATCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002986    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003828.x-2185s1c1
Sequence:CCGGCTGGCTGACTAGGACTGTTAACTCGAGTTAACAGTCCTAGTCAGCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003828.x-413s1c1
Sequence:CCGGCAAGGCTCTAAGGGATGGAAACTCGAGTTTCCATCCCTTAGAGCCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016985
VALIDATED
MTMR1 MISSION shRNA Bacterial Glycerol Stock
myotubularin related protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000340260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016985.2-1539s21c1
Sequence:CCGGAGTTATTACCGGACCATTAAACTCGAGTTTAATGGTCCGGTAATAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016985.2-955s21c1
Sequence:CCGGCCATCATTGTTGTGCCAACTACTCGAGTAGTTGGCACAACAATGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016985.2-545s21c1
Sequence:CCGGCCTGACAGTGACGGACTTTAACTCGAGTTAAAGTCCGTCACTGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016985.2-1425s1c1
Sequence:CCGGGCAGTGAGAATTGCTGATAAACTCGAGTTTATCAGCAATTCTCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081338    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016985.2-4179s1c1
Sequence:CCGGCCCTAGAAATACTGTGTAATTCTCGAGAATTACACAGTATTTCTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016985.2-545s1c1
Sequence:CCGGCCTGACAGTGACGGACTTTAACTCGAGTTAAAGTCCGTCACTGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016985.2-955s1c1
Sequence:CCGGCCATCATTGTTGTGCCAACTACTCGAGTAGTTGGCACAACAATGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016985.2-1139s1c1
Sequence:CCGGGCAGACAATAATGGATGCTAACTCGAGTTAGCATCCATTATTGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016985.2-4179s21c1
Sequence:CCGGCCCTAGAAATACTGTGTAATTCTCGAGAATTACACAGTATTTCTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016985.2-1649s21c1
Sequence:CCGGTGCTGACCGATCACCTATATTCTCGAGAATATAGGTGATCGGTCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016985
VALIDATED
MTMR1 MISSION shRNA shRNA Plasmid DNA
myotubularin related protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000340260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016985.2-1539s21c1
Sequence:CCGGAGTTATTACCGGACCATTAAACTCGAGTTTAATGGTCCGGTAATAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016985.2-955s21c1
Sequence:CCGGCCATCATTGTTGTGCCAACTACTCGAGTAGTTGGCACAACAATGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016985.2-545s21c1
Sequence:CCGGCCTGACAGTGACGGACTTTAACTCGAGTTAAAGTCCGTCACTGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016985.2-1425s1c1
Sequence:CCGGGCAGTGAGAATTGCTGATAAACTCGAGTTTATCAGCAATTCTCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081338    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016985.2-4179s1c1
Sequence:CCGGCCCTAGAAATACTGTGTAATTCTCGAGAATTACACAGTATTTCTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016985.2-545s1c1
Sequence:CCGGCCTGACAGTGACGGACTTTAACTCGAGTTAAAGTCCGTCACTGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016985.2-955s1c1
Sequence:CCGGCCATCATTGTTGTGCCAACTACTCGAGTAGTTGGCACAACAATGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016985.2-1139s1c1
Sequence:CCGGGCAGACAATAATGGATGCTAACTCGAGTTAGCATCCATTATTGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016985.2-4179s21c1
Sequence:CCGGCCCTAGAAATACTGTGTAATTCTCGAGAATTACACAGTATTTCTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016985.2-1649s21c1
Sequence:CCGGTGCTGACCGATCACCTATATTCTCGAGAATATAGGTGATCGGTCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016985
VALIDATED
MTMR1 MISSION shRNA Lentiviral Transduction Particles
myotubularin related protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000340260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016985.2-1539s21c1
Sequence:CCGGAGTTATTACCGGACCATTAAACTCGAGTTTAATGGTCCGGTAATAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016985.2-955s21c1
Sequence:CCGGCCATCATTGTTGTGCCAACTACTCGAGTAGTTGGCACAACAATGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016985.2-545s21c1
Sequence:CCGGCCTGACAGTGACGGACTTTAACTCGAGTTAAAGTCCGTCACTGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016985.2-1425s1c1
Sequence:CCGGGCAGTGAGAATTGCTGATAAACTCGAGTTTATCAGCAATTCTCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081338    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016985.2-4179s1c1
Sequence:CCGGCCCTAGAAATACTGTGTAATTCTCGAGAATTACACAGTATTTCTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016985.2-545s1c1
Sequence:CCGGCCTGACAGTGACGGACTTTAACTCGAGTTAAAGTCCGTCACTGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016985.2-955s1c1
Sequence:CCGGCCATCATTGTTGTGCCAACTACTCGAGTAGTTGGCACAACAATGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016985.2-1139s1c1
Sequence:CCGGGCAGACAATAATGGATGCTAACTCGAGTTAGCATCCATTATTGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016985.2-4179s21c1
Sequence:CCGGCCCTAGAAATACTGTGTAATTCTCGAGAATTACACAGTATTTCTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016985.2-1649s21c1
Sequence:CCGGTGCTGACCGATCACCTATATTCTCGAGAATATAGGTGATCGGTCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)