EMAIL THIS PAGE TO A FRIEND

MTMR2

myotubularin related protein 2

153 Gene Product Result for
Synonyms: CMT4B CMT4B1
UniProtKB ID: Q13614, A6NN98, Q9UPS9
Gene ID:
Human(8898) Summary: This gene is a member of the myotubularin family of phosphoinositide lipid phosphatases. The encoded protein possesses phosphatase activity towards phosphatidylinositol-3-phosphate and phosphatidylinositol-3,5-bisphosphate. Mutations in this gene are a cause of Charcot-Marie-Tooth disease type 4B, an autosomal recessive demyelinating neuropathy. Alternatively spliced transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Mouse(77116) myotubularin related protein 2
Rat(315422) myotubularin related protein 2
Zebrafish(30644) myotubularin related protein 2
Horse(100067900) myotubularin related protein 2
cow(536810) myotubularin related protein 2
dog(606918) myotubularin related protein 2
chicken(418992) myotubularin related protein 2
domestic guinea pig(100720535) myotubularin related protein 2
Domestic Rabbit(100352381) myotubularin related protein 2
naked mole-rat(101718842) myotubularin related protein 2
sheep(101123404) myotubularin related protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016156 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016156 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016156 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023858 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023858 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023858 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016156 siRNAs that have been validated in the lab human pricing
NM_201278 siRNAs that have been validated in the lab human pricing
NM_201281 siRNAs that have been validated in the lab human pricing
NR_023354 Rosetta Predictions human pricing
NR_023355 Rosetta Predictions human pricing
NR_023356 Rosetta Predictions human pricing
NM_001108123 Rosetta Predictions rat pricing
NM_023858 Rosetta Predictions mouse pricing
NR_024025 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016156 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132910 validated 2243
2 SASI_Hs01_00132911 predicted 1796
3 SASI_Hs01_00132912 predicted 1909
4 SASI_Hs01_00132913 predicted 2081
5 SASI_Hs01_00132914 predicted 2022
6 SASI_Hs01_00132915 predicted 1544
7 SASI_Hs01_00132917 predicted 774
8 SASI_Hs02_00348962 predicted 714
9 SASI_Hs01_00132918 predicted 760
10 SASI_Hs01_00132919 predicted 1398
11 SASI_Hs01_00132916 predicted 671
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201278 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019082 validated 2338
2 SASI_Hs01_00019083 predicted 1904
3 SASI_Hs01_00019084 predicted 2009
4 SASI_Hs01_00019085 predicted 2180
5 SASI_Hs01_00019086 predicted 2122
6 SASI_Hs01_00019087 predicted 1652
7 SASI_Hs01_00019088 predicted 870
8 SASI_Hs01_00019089 predicted 875
9 SASI_Hs01_00019090 predicted 865
10 SASI_Hs01_00019091 predicted 1502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201281 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155860 validated 2222
2 SASI_Hs01_00155861 predicted 1776
3 SASI_Hs01_00155862 predicted 1883
4 SASI_Hs01_00155863 predicted 2060
5 SASI_Hs01_00155864 predicted 1997
6 SASI_Hs01_00155865 predicted 1525
7 SASI_Hs01_00155866 predicted 743
8 SASI_Hs01_00155867 predicted 759
9 SASI_Hs01_00155868 predicted 742
10 SASI_Hs01_00155869 predicted 1379
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_023354 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381792 predicted 2395
2 SASI_Hs02_00381793 predicted 3050
3 SASI_Hs02_00381794 predicted 1952
4 SASI_Hs02_00381795 predicted 2064
5 SASI_Hs02_00381796 predicted 2245
6 SASI_Hs02_00381797 predicted 2176
7 SASI_Hs02_00381798 predicted 3285
8 SASI_Hs02_00381799 predicted 1700
9 SASI_Hs02_00381800 predicted 934
10 SASI_Hs02_00381801 predicted 3108
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_023355 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381802 predicted 2273
2 SASI_Hs02_00381803 predicted 2931
3 SASI_Hs02_00381804 predicted 1831
4 SASI_Hs02_00381805 predicted 1947
5 SASI_Hs02_00381806 predicted 2122
6 SASI_Hs02_00381807 predicted 2051
7 SASI_Hs02_00381808 predicted 3160
8 SASI_Hs02_00381809 predicted 1575
9 SASI_Hs02_00381810 predicted 2993
10 SASI_Hs02_00381811 predicted 4213
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_023356 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381812 predicted 2348
2 SASI_Hs02_00381813 predicted 3004
3 SASI_Hs02_00381814 predicted 1910
4 SASI_Hs02_00381815 predicted 2018
5 SASI_Hs02_00381816 predicted 2190
6 SASI_Hs02_00381817 predicted 518
7 SASI_Hs02_00381818 predicted 2126
8 SASI_Hs02_00381819 predicted 3238
9 SASI_Hs02_00381820 predicted 1650
10 SASI_Hs02_00381821 predicted 3060
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108123 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235584 predicted 1308
2 SASI_Rn02_00235585 predicted 1144
3 SASI_Rn02_00235586 predicted 2515
4 SASI_Rn02_00235587 predicted 2334
5 SASI_Rn02_00235588 predicted 1100
6 SASI_Rn02_00235589 predicted 2934
7 SASI_Rn02_00235590 predicted 1516
8 SASI_Rn02_00235591 predicted 2540
9 SASI_Rn02_00235592 predicted 1095
10 SASI_Rn02_00235593 predicted 1508
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023858 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327406 predicted 1728
2 SASI_Mm01_00170023 predicted 2086
3 SASI_Mm01_00170024 predicted 1902
4 SASI_Mm02_00327407 predicted 1664
5 SASI_Mm02_00327408 predicted 281
6 SASI_Mm01_00170028 predicted 1891
7 SASI_Mm02_00327409 predicted 1680
8 SASI_Mm02_00327410 predicted 1914
9 SASI_Mm01_00170032 predicted 1817
10 SASI_Mm02_00327411 predicted 1974
11 SASI_Mm01_00170025 predicted 1427
12 SASI_Mm01_00170026 predicted 1043
13 SASI_Mm01_00170027 predicted 1444
14 SASI_Mm01_00170029 predicted 1422
15 SASI_Mm01_00170030 predicted 1302
16 SASI_Mm01_00170031 predicted 1017
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_024025 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00354458 predicted 2190
2 SASI_Mm02_00354459 predicted 2006
3 SASI_Mm02_00354460 predicted 1770
4 SASI_Mm02_00354461 predicted 2390
5 SASI_Mm02_00354462 predicted 379
6 SASI_Mm02_00354463 predicted 2299
7 SASI_Mm02_00354464 predicted 1994
8 SASI_Mm02_00354465 predicted 403
9 SASI_Mm02_00354466 predicted 1921
10 SASI_Mm02_00354467 predicted 1907
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016156
VALIDATED
MTMR2 MISSION shRNA Bacterial Glycerol Stock
myotubularin related protein 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016156.x-1305s1c1
Sequence:CCGGCGGCCAAGTGTTAATGCTGTTCTCGAGAACAGCATTAACACTTGGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016156.x-488s1c1
Sequence:CCGGCATTTCAACTTCTGCCGACAACTCGAGTTGTCGGCAGAAGTTGAAATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016156.x-1989s1c1
Sequence:CCGGGACTTCACTAATCCTCTCTATCTCGAGATAGAGAGGATTAGTGAAGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016156.x-1035s1c1
Sequence:CCGGGAACGATATGAACTTTGTGATCTCGAGATCACAAAGTTCATATCGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016156.x-4442s1c1
Sequence:CCGGCCCTTGTGACTAATTCCTATTCTCGAGAATAGGAATTAGTCACAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016156.5-1568s21c1
Sequence:GTACCGGTATCGAACCATCCGAGGATTTCTCGAGAAATCCTCGGATGGTTCGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016156.5-1217s21c1
Sequence:CCGGCGGCCAAGTGTTAATGCTGTTCTCGAGAACAGCATTAACACTTGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016156.5-572s21c1
Sequence:CCGGGTCACGAATTATAGGTTATATCTCGAGATATAACCTATAATTCGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293427    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016156.5-2247s21c1
Sequence:CCGGGTAGAAAGTCTTCGGAATTTACTCGAGTAAATTCCGAAGACTTTCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016156.5-760s21c1
Sequence:CCGGGCGGACAAGAAGATCCATATTCTCGAGAATATGGATCTTCTTGTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016156.5-947s21c1
Sequence:CCGGGAACGATATGAACTTTGTGATCTCGAGATCACAAAGTTCATATCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016156.5-1972s21c1
Sequence:GTACCGGAGAGCTCTGGGTGGGATATTACTCGAGTAATATCCCACCCAGAGCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016156
VALIDATED
MTMR2 MISSION shRNA shRNA Plasmid DNA
myotubularin related protein 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016156.x-1305s1c1
Sequence:CCGGCGGCCAAGTGTTAATGCTGTTCTCGAGAACAGCATTAACACTTGGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016156.x-488s1c1
Sequence:CCGGCATTTCAACTTCTGCCGACAACTCGAGTTGTCGGCAGAAGTTGAAATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016156.x-1989s1c1
Sequence:CCGGGACTTCACTAATCCTCTCTATCTCGAGATAGAGAGGATTAGTGAAGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016156.x-1035s1c1
Sequence:CCGGGAACGATATGAACTTTGTGATCTCGAGATCACAAAGTTCATATCGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016156.x-4442s1c1
Sequence:CCGGCCCTTGTGACTAATTCCTATTCTCGAGAATAGGAATTAGTCACAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016156.5-1568s21c1
Sequence:GTACCGGTATCGAACCATCCGAGGATTTCTCGAGAAATCCTCGGATGGTTCGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016156.5-1217s21c1
Sequence:CCGGCGGCCAAGTGTTAATGCTGTTCTCGAGAACAGCATTAACACTTGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016156.5-572s21c1
Sequence:CCGGGTCACGAATTATAGGTTATATCTCGAGATATAACCTATAATTCGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293427    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016156.5-2247s21c1
Sequence:CCGGGTAGAAAGTCTTCGGAATTTACTCGAGTAAATTCCGAAGACTTTCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016156.5-760s21c1
Sequence:CCGGGCGGACAAGAAGATCCATATTCTCGAGAATATGGATCTTCTTGTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016156.5-947s21c1
Sequence:CCGGGAACGATATGAACTTTGTGATCTCGAGATCACAAAGTTCATATCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016156.5-1972s21c1
Sequence:GTACCGGAGAGCTCTGGGTGGGATATTACTCGAGTAATATCCCACCCAGAGCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016156
VALIDATED
MTMR2 MISSION shRNA Lentiviral Transduction Particles
myotubularin related protein 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016156.x-1305s1c1
Sequence:CCGGCGGCCAAGTGTTAATGCTGTTCTCGAGAACAGCATTAACACTTGGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016156.x-488s1c1
Sequence:CCGGCATTTCAACTTCTGCCGACAACTCGAGTTGTCGGCAGAAGTTGAAATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016156.x-1989s1c1
Sequence:CCGGGACTTCACTAATCCTCTCTATCTCGAGATAGAGAGGATTAGTGAAGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016156.x-1035s1c1
Sequence:CCGGGAACGATATGAACTTTGTGATCTCGAGATCACAAAGTTCATATCGTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016156.x-4442s1c1
Sequence:CCGGCCCTTGTGACTAATTCCTATTCTCGAGAATAGGAATTAGTCACAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016156.5-1568s21c1
Sequence:GTACCGGTATCGAACCATCCGAGGATTTCTCGAGAAATCCTCGGATGGTTCGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016156.5-1217s21c1
Sequence:CCGGCGGCCAAGTGTTAATGCTGTTCTCGAGAACAGCATTAACACTTGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016156.5-572s21c1
Sequence:CCGGGTCACGAATTATAGGTTATATCTCGAGATATAACCTATAATTCGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293427    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016156.5-2247s21c1
Sequence:CCGGGTAGAAAGTCTTCGGAATTTACTCGAGTAAATTCCGAAGACTTTCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016156.5-760s21c1
Sequence:CCGGGCGGACAAGAAGATCCATATTCTCGAGAATATGGATCTTCTTGTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016156.5-947s21c1
Sequence:CCGGGAACGATATGAACTTTGTGATCTCGAGATCACAAAGTTCATATCGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016156.5-1972s21c1
Sequence:GTACCGGAGAGCTCTGGGTGGGATATTACTCGAGTAATATCCCACCCAGAGCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023858
VALIDATED
MTMR2 MISSION shRNA Bacterial Glycerol Stock
myotubularin related protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023858.1-1418s1c1
Sequence:CCGGGCGAACAAGAAGATCCATATTCTCGAGAATATGGATCTTCTTGTTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023858.1-1173s1c1
Sequence:CCGGGCCAAAGATGTGACTTACATACTCGAGTATGTAAGTCACATCTTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023858.1-2584s1c1
Sequence:CCGGGCTACTCCAATCATGTCCTTTCTCGAGAAAGGACATGATTGGAGTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023858.1-2548s1c1
Sequence:CCGGGCCAGCTGGAAGACTTTACTACTCGAGTAGTAAAGTCTTCCAGCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023858.1-1979s1c1
Sequence:CCGGCCATGTTATGAGAGAATCATTCTCGAGAATGATTCTCTCATAACATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023858
VALIDATED
MTMR2 MISSION shRNA shRNA Plasmid DNA
myotubularin related protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023858.1-1418s1c1
Sequence:CCGGGCGAACAAGAAGATCCATATTCTCGAGAATATGGATCTTCTTGTTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023858.1-1173s1c1
Sequence:CCGGGCCAAAGATGTGACTTACATACTCGAGTATGTAAGTCACATCTTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023858.1-2584s1c1
Sequence:CCGGGCTACTCCAATCATGTCCTTTCTCGAGAAAGGACATGATTGGAGTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023858.1-2548s1c1
Sequence:CCGGGCCAGCTGGAAGACTTTACTACTCGAGTAGTAAAGTCTTCCAGCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023858.1-1979s1c1
Sequence:CCGGCCATGTTATGAGAGAATCATTCTCGAGAATGATTCTCTCATAACATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023858
VALIDATED
MTMR2 MISSION shRNA Lentiviral Transduction Particles
myotubularin related protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023858.1-1418s1c1
Sequence:CCGGGCGAACAAGAAGATCCATATTCTCGAGAATATGGATCTTCTTGTTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023858.1-1173s1c1
Sequence:CCGGGCCAAAGATGTGACTTACATACTCGAGTATGTAAGTCACATCTTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023858.1-2584s1c1
Sequence:CCGGGCTACTCCAATCATGTCCTTTCTCGAGAAAGGACATGATTGGAGTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023858.1-2548s1c1
Sequence:CCGGGCCAGCTGGAAGACTTTACTACTCGAGTAGTAAAGTCTTCCAGCTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023858.1-1979s1c1
Sequence:CCGGCCATGTTATGAGAGAATCATTCTCGAGAATGATTCTCTCATAACATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)