EMAIL THIS PAGE TO A FRIEND

MTMR3

myotubularin related protein 3

228 Gene Product Result for
Synonyms: FYVE-DSP1 ZFYVE10
Gene ID:
Human(8897) Summary: This gene encodes a member of the myotubularin dual specificity protein phosphatase gene family. The encoded protein is structurally similar to myotubularin but in addition contains a FYVE domain and an N-terminal PH-GRAM domain. The protein can self-associate and also form heteromers with another myotubularin related protein. The protein binds to phosphoinositide lipids through the PH-GRAM domain, and can hydrolyze phosphatidylinositol(3)-phosphate and phosphatidylinositol(3,5)-biphosphate in vitro. The encoded protein has been observed to have a perinuclear, possibly membrane-bound, distribution in cells, but it has also been found free in the cytoplasm. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(74302) myotubularin related protein 3
Rat(305482) myotubularin related protein 3
sheep(101109302) myotubularin related protein 3
naked mole-rat(101710657) myotubularin related protein 3
Domestic Rabbit(100341987) myotubularin related protein 3
domestic guinea pig(100725247) myotubularin related protein 3
Zebrafish(393838) myotubularin related protein 3
cow(535099) myotubularin related protein 3
Horse(100058825) myotubularin related protein 3
domestic cat(101089469) myotubularin related protein 3
dog(486349) myotubularin related protein 3
chicken(417015) myotubularin related protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028860 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028860 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028860 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021090 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021090 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021090 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021090 siRNAs that have been validated in the lab human pricing
NM_153050 Rosetta Predictions human pricing
NM_153051 Rosetta Predictions human pricing
NM_001012038 Rosetta Predictions rat pricing
XM_573642 Rosetta Predictions rat pricing
NM_028860 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021090 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142125 validated 533
2 SASI_Hs01_00142126 predicted 606
3 SASI_Hs01_00142127 predicted 2873
4 SASI_Hs01_00142129 predicted 515
5 SASI_Hs01_00142130 predicted 1501
6 SASI_Hs01_00142131 predicted 892
7 SASI_Hs01_00142132 predicted 1784
8 SASI_Hs02_00354577 predicted 2798
9 SASI_Hs01_00142134 predicted 2455
10 SASI_Hs02_00354578 predicted 2978
11 SASI_Hs01_00142128 predicted 827
12 SASI_Hs01_00142133 predicted 1939
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153050 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081344 predicted 533
2 SASI_Hs01_00081345 predicted 608
3 SASI_Hs01_00081346 predicted 2872
4 SASI_Hs01_00081348 predicted 516
5 SASI_Hs01_00081349 predicted 1497
6 SASI_Hs01_00081350 predicted 892
7 SASI_Hs01_00081351 predicted 1788
8 SASI_Hs02_00367005 predicted 2797
9 SASI_Hs01_00081353 predicted 2460
10 SASI_Hs02_00367006 predicted 2983
11 SASI_Hs01_00081347 predicted 831
12 SASI_Hs01_00081352 predicted 1933
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153051 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117005 predicted 533
2 SASI_Hs01_00117006 predicted 608
3 SASI_Hs01_00117007 predicted 2876
4 SASI_Hs01_00117009 predicted 514
5 SASI_Hs01_00117010 predicted 1503
6 SASI_Hs01_00117011 predicted 888
7 SASI_Hs01_00117012 predicted 1787
8 SASI_Hs02_00367007 predicted 2797
9 SASI_Hs01_00117014 predicted 2453
10 SASI_Hs02_00367008 predicted 2977
11 SASI_Hs01_00117008 predicted 834
12 SASI_Hs01_00117013 predicted 1939
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012038 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092037 predicted 1620
2 SASI_Rn01_00092038 predicted 1225
3 SASI_Rn01_00092039 predicted 3775
4 SASI_Rn01_00092041 predicted 3693
5 SASI_Rn01_00092042 predicted 3645
6 SASI_Rn02_00200136 predicted 3159
7 SASI_Rn01_00092043 predicted 1080
8 SASI_Rn01_00092044 predicted 1854
9 SASI_Rn01_00092045 predicted 416
10 SASI_Rn02_00200137 predicted 388
11 SASI_Rn01_00092040 predicted 3626
12 SASI_Rn01_00092046 predicted 1321
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573642 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00175347 predicted 1439
2 SASI_Rn01_00175348 predicted 1050
3 SASI_Rn01_00175349 predicted 3228
4 SASI_Rn01_00175350 predicted 584
5 SASI_Rn01_00175351 predicted 889
6 SASI_Rn01_00175352 predicted 1664
7 SASI_Rn01_00175353 predicted 503
8 SASI_Rn01_00175354 predicted 229
9 SASI_Rn01_00175355 predicted 1133
10 SASI_Rn01_00175356 predicted 1037
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028860 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115565 predicted 3599
2 SASI_Mm02_00334534 predicted 3749
3 SASI_Mm01_00115566 predicted 1814
4 SASI_Mm01_00115567 predicted 1317
5 SASI_Mm02_00334535 predicted 3658
6 SASI_Mm01_00115570 predicted 1939
7 SASI_Mm01_00115571 predicted 594
8 SASI_Mm01_00115572 predicted 1309
9 SASI_Mm02_00334536 predicted 852
10 SASI_Mm01_00115574 predicted 2831
11 SASI_Mm01_00115568 predicted 595
12 SASI_Mm01_00115569 predicted 2900
13 SASI_Mm01_00115573 predicted 490
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028860
VALIDATED
MTMR3 MISSION shRNA Bacterial Glycerol Stock
myotubularin related protein 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285813    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028860.2-3902s21c1
Sequence:CCGGGATGTACCACTGGATTGTAAACTCGAGTTTACAATCCAGTGGTACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028860.2-3030s21c1
Sequence:CCGGTTGTGCCTTGCCGTTAGATAACTCGAGTTATCTAACGGCAAGGCACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028860.2-527s21c1
Sequence:CCGGGCGTTGAATGCCGTGATATATCTCGAGATATATCACGGCATTCAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028860.2-1579s21c1
Sequence:CCGGCTCCTACTTGACCCTTATTACCTCGAGGTAATAAGGGTCAAGTAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028860.2-1918s21c1
Sequence:CCGGGCAGGCAACAAGGCTTTCAAACTCGAGTTTGAAAGCCTTGTTGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030089    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028860.1-3591s1c1
Sequence:CCGGGCAGGAATTGTGGGAATGTATCTCGAGATACATTCCCACAATTCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028860.1-1901s1c1
Sequence:CCGGGCAGGCAACAAGGCTTTCAAACTCGAGTTTGAAAGCCTTGTTGCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028860.1-3464s1c1
Sequence:CCGGCTGCGCTTCAATGGAGACTTTCTCGAGAAAGTCTCCATTGAAGCGCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028860.1-2477s1c1
Sequence:CCGGCCCGTTGTACTTTACCAAGAACTCGAGTTCTTGGTAAAGTACAACGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028860.1-3132s1c1
Sequence:CCGGCCAATGGGCATTGTGCCAATTCTCGAGAATTGGCACAATGCCCATTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028860
VALIDATED
MTMR3 MISSION shRNA shRNA Plasmid DNA
myotubularin related protein 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285813    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028860.2-3902s21c1
Sequence:CCGGGATGTACCACTGGATTGTAAACTCGAGTTTACAATCCAGTGGTACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028860.2-3030s21c1
Sequence:CCGGTTGTGCCTTGCCGTTAGATAACTCGAGTTATCTAACGGCAAGGCACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028860.2-527s21c1
Sequence:CCGGGCGTTGAATGCCGTGATATATCTCGAGATATATCACGGCATTCAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028860.2-1579s21c1
Sequence:CCGGCTCCTACTTGACCCTTATTACCTCGAGGTAATAAGGGTCAAGTAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028860.2-1918s21c1
Sequence:CCGGGCAGGCAACAAGGCTTTCAAACTCGAGTTTGAAAGCCTTGTTGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030089    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028860.1-3591s1c1
Sequence:CCGGGCAGGAATTGTGGGAATGTATCTCGAGATACATTCCCACAATTCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028860.1-1901s1c1
Sequence:CCGGGCAGGCAACAAGGCTTTCAAACTCGAGTTTGAAAGCCTTGTTGCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028860.1-3464s1c1
Sequence:CCGGCTGCGCTTCAATGGAGACTTTCTCGAGAAAGTCTCCATTGAAGCGCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028860.1-2477s1c1
Sequence:CCGGCCCGTTGTACTTTACCAAGAACTCGAGTTCTTGGTAAAGTACAACGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028860.1-3132s1c1
Sequence:CCGGCCAATGGGCATTGTGCCAATTCTCGAGAATTGGCACAATGCCCATTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028860
VALIDATED
MTMR3 MISSION shRNA Lentiviral Transduction Particles
myotubularin related protein 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285813    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028860.2-3902s21c1
Sequence:CCGGGATGTACCACTGGATTGTAAACTCGAGTTTACAATCCAGTGGTACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028860.2-3030s21c1
Sequence:CCGGTTGTGCCTTGCCGTTAGATAACTCGAGTTATCTAACGGCAAGGCACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028860.2-527s21c1
Sequence:CCGGGCGTTGAATGCCGTGATATATCTCGAGATATATCACGGCATTCAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028860.2-1579s21c1
Sequence:CCGGCTCCTACTTGACCCTTATTACCTCGAGGTAATAAGGGTCAAGTAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028860.2-1918s21c1
Sequence:CCGGGCAGGCAACAAGGCTTTCAAACTCGAGTTTGAAAGCCTTGTTGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030089    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028860.1-3591s1c1
Sequence:CCGGGCAGGAATTGTGGGAATGTATCTCGAGATACATTCCCACAATTCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028860.1-1901s1c1
Sequence:CCGGGCAGGCAACAAGGCTTTCAAACTCGAGTTTGAAAGCCTTGTTGCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028860.1-3464s1c1
Sequence:CCGGCTGCGCTTCAATGGAGACTTTCTCGAGAAAGTCTCCATTGAAGCGCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028860.1-2477s1c1
Sequence:CCGGCCCGTTGTACTTTACCAAGAACTCGAGTTCTTGGTAAAGTACAACGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028860.1-3132s1c1
Sequence:CCGGCCAATGGGCATTGTGCCAATTCTCGAGAATTGGCACAATGCCCATTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021090
VALIDATED
MTMR3 MISSION shRNA Bacterial Glycerol Stock
myotubularin related protein 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_021090.x-3034s1c1
Sequence:CCGGCCTTGCCTTTAGCCGAATGTACTCGAGTACATTCGGCTAAAGGCAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_021090.x-1191s1c1
Sequence:CCGGGCAGAGAGTTTAGCCATCCAACTCGAGTTGGATGGCTAAACTCTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021090.x-3838s1c1
Sequence:CCGGGCATTGACCTTGAACTGGATACTCGAGTATCCAGTTCAAGGTCAATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021090.x-3787s1c1
Sequence:CCGGCCAGTCGAGTATGCAAGTCTTCTCGAGAAGACTTGCATACTCGACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003015    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_021090.x-5786s1c1
Sequence:CCGGCCGTAACTCTCCATAGCTGTACTCGAGTACAGCTATGGAGAGTTACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021090
VALIDATED
MTMR3 MISSION shRNA shRNA Plasmid DNA
myotubularin related protein 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_021090.x-3034s1c1
Sequence:CCGGCCTTGCCTTTAGCCGAATGTACTCGAGTACATTCGGCTAAAGGCAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_021090.x-1191s1c1
Sequence:CCGGGCAGAGAGTTTAGCCATCCAACTCGAGTTGGATGGCTAAACTCTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021090.x-3838s1c1
Sequence:CCGGGCATTGACCTTGAACTGGATACTCGAGTATCCAGTTCAAGGTCAATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021090.x-3787s1c1
Sequence:CCGGCCAGTCGAGTATGCAAGTCTTCTCGAGAAGACTTGCATACTCGACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003015    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_021090.x-5786s1c1
Sequence:CCGGCCGTAACTCTCCATAGCTGTACTCGAGTACAGCTATGGAGAGTTACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021090
VALIDATED
MTMR3 MISSION shRNA Lentiviral Transduction Particles
myotubularin related protein 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_021090.x-3034s1c1
Sequence:CCGGCCTTGCCTTTAGCCGAATGTACTCGAGTACATTCGGCTAAAGGCAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_021090.x-1191s1c1
Sequence:CCGGGCAGAGAGTTTAGCCATCCAACTCGAGTTGGATGGCTAAACTCTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021090.x-3838s1c1
Sequence:CCGGGCATTGACCTTGAACTGGATACTCGAGTATCCAGTTCAAGGTCAATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021090.x-3787s1c1
Sequence:CCGGCCAGTCGAGTATGCAAGTCTTCTCGAGAAGACTTGCATACTCGACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003015    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_021090.x-5786s1c1
Sequence:CCGGCCGTAACTCTCCATAGCTGTACTCGAGTACAGCTATGGAGAGTTACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)