EMAIL THIS PAGE TO A FRIEND

MTMR4

myotubularin related protein 4

236 Gene Product Result for
Synonyms: FYVE-DSP2 ZFYVE11
UniProtKB ID: Q9NYA4, D3DTZ6, Q8IV27, Q9Y4D5
Gene ID:
Mouse(170749) myotubularin related protein 4
Rat(287607) myotubularin related protein 4
chicken(417472) myotubularin related protein 4
dog(480570) myotubularin related protein 4
Horse(100070938) myotubularin related protein 4
cow(782743) myotubularin related protein 4
domestic cat(101082607) myotubularin related protein 4
domestic guinea pig(100724742) myotubularin related protein 4
Domestic Rabbit(100340433) myotubularin related protein 4
naked mole-rat(101712041) myotubularin related protein 4
sheep(101105343) myotubularin related protein 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004687 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004687 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004687 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133215 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133215 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133215 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004687 Rosetta Predictions human pricing
NM_001105827 Rosetta Predictions rat pricing
NM_133215 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004687 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120293 predicted 2994
2 SASI_Hs01_00120294 predicted 3042
3 SASI_Hs01_00120295 predicted 2168
4 SASI_Hs01_00120296 predicted 2749
5 SASI_Hs01_00120297 predicted 3130
6 SASI_Hs01_00120298 predicted 2011
7 SASI_Hs02_00338122 predicted 1192
8 SASI_Hs01_00120300 predicted 2380
9 SASI_Hs02_00338123 predicted 3735
10 SASI_Hs01_00120301 predicted 3408
11 SASI_Hs01_00120292 predicted 569
12 SASI_Hs01_00120299 predicted 2968
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105827 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212916 predicted 2607
2 SASI_Rn02_00212917 predicted 2109
3 SASI_Rn02_00212918 predicted 1680
4 SASI_Rn02_00212919 predicted 3144
5 SASI_Rn02_00212920 predicted 2033
6 SASI_Rn02_00212921 predicted 2732
7 SASI_Rn02_00212922 predicted 3397
8 SASI_Rn02_00212923 predicted 231
9 SASI_Rn02_00212924 predicted 3157
10 SASI_Rn02_00212925 predicted 2862
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133215 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034617 predicted 2121
2 SASI_Mm01_00034618 predicted 3127
3 SASI_Mm01_00034619 predicted 315
4 SASI_Mm01_00034620 predicted 2700
5 SASI_Mm01_00034621 predicted 2037
6 SASI_Mm02_00338417 predicted 330
7 SASI_Mm01_00034623 predicted 2796
8 SASI_Mm01_00034624 predicted 3398
9 SASI_Mm01_00034625 predicted 604
10 SASI_Mm01_00034626 predicted 1377
11 SASI_Mm01_00034622 predicted 2174
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004687
VALIDATED
MTMR4 MISSION shRNA Bacterial Glycerol Stock
myotubularin related protein 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000279996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004687.4-350s21c1
Sequence:CCGGGAGCCGTGATATGTTCCAGTTCTCGAGAACTGGAACATATCACGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002991    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004687.x-4764s1c1
Sequence:CCGGGCTGTCTATTTCTGTGCACTTCTCGAGAAGTGCACAGAAATAGACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004687.x-3134s1c1
Sequence:CCGGCCAGCATAGGTTACGGCAAATCTCGAGATTTGCCGTAACCTATGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004687.x-311s1c1
Sequence:CCGGGAGCCGTGATATGTTCCAGTTCTCGAGAACTGGAACATATCACGGCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004687.x-1524s1c1
Sequence:CCGGCCCTGCCTGTTTGAATTTAATCTCGAGATTAAATTCAAACAGGCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004687.x-3087s1c1
Sequence:CCGGCCTCTGTATTTGGATGATGATCTCGAGATCATCATCCAAATACAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004687.4-1563s21c1
Sequence:CCGGCCCTGCCTGTTTGAATTTAATCTCGAGATTAAATTCAAACAGGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004687.4-3173s21c1
Sequence:CCGGCCAGCATAGGTTACGGCAAATCTCGAGATTTGCCGTAACCTATGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_004687.4-2714s21c1
Sequence:CCGGTAATAGGAATGGGCAGTTATTCTCGAGAATAACTGCCCATTCCTATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004687.4-4803s21c1
Sequence:CCGGGCTGTCTATTTCTGTGCACTTCTCGAGAAGTGCACAGAAATAGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004687
VALIDATED
MTMR4 MISSION shRNA shRNA Plasmid DNA
myotubularin related protein 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000279996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004687.4-350s21c1
Sequence:CCGGGAGCCGTGATATGTTCCAGTTCTCGAGAACTGGAACATATCACGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002991    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004687.x-4764s1c1
Sequence:CCGGGCTGTCTATTTCTGTGCACTTCTCGAGAAGTGCACAGAAATAGACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004687.x-3134s1c1
Sequence:CCGGCCAGCATAGGTTACGGCAAATCTCGAGATTTGCCGTAACCTATGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004687.x-311s1c1
Sequence:CCGGGAGCCGTGATATGTTCCAGTTCTCGAGAACTGGAACATATCACGGCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004687.x-1524s1c1
Sequence:CCGGCCCTGCCTGTTTGAATTTAATCTCGAGATTAAATTCAAACAGGCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004687.x-3087s1c1
Sequence:CCGGCCTCTGTATTTGGATGATGATCTCGAGATCATCATCCAAATACAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004687.4-1563s21c1
Sequence:CCGGCCCTGCCTGTTTGAATTTAATCTCGAGATTAAATTCAAACAGGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004687.4-3173s21c1
Sequence:CCGGCCAGCATAGGTTACGGCAAATCTCGAGATTTGCCGTAACCTATGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_004687.4-2714s21c1
Sequence:CCGGTAATAGGAATGGGCAGTTATTCTCGAGAATAACTGCCCATTCCTATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004687.4-4803s21c1
Sequence:CCGGGCTGTCTATTTCTGTGCACTTCTCGAGAAGTGCACAGAAATAGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004687
VALIDATED
MTMR4 MISSION shRNA Lentiviral Transduction Particles
myotubularin related protein 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000279996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004687.4-350s21c1
Sequence:CCGGGAGCCGTGATATGTTCCAGTTCTCGAGAACTGGAACATATCACGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002991    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004687.x-4764s1c1
Sequence:CCGGGCTGTCTATTTCTGTGCACTTCTCGAGAAGTGCACAGAAATAGACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004687.x-3134s1c1
Sequence:CCGGCCAGCATAGGTTACGGCAAATCTCGAGATTTGCCGTAACCTATGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004687.x-311s1c1
Sequence:CCGGGAGCCGTGATATGTTCCAGTTCTCGAGAACTGGAACATATCACGGCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004687.x-1524s1c1
Sequence:CCGGCCCTGCCTGTTTGAATTTAATCTCGAGATTAAATTCAAACAGGCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004687.x-3087s1c1
Sequence:CCGGCCTCTGTATTTGGATGATGATCTCGAGATCATCATCCAAATACAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004687.4-1563s21c1
Sequence:CCGGCCCTGCCTGTTTGAATTTAATCTCGAGATTAAATTCAAACAGGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004687.4-3173s21c1
Sequence:CCGGCCAGCATAGGTTACGGCAAATCTCGAGATTTGCCGTAACCTATGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_004687.4-2714s21c1
Sequence:CCGGTAATAGGAATGGGCAGTTATTCTCGAGAATAACTGCCCATTCCTATTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004687.4-4803s21c1
Sequence:CCGGGCTGTCTATTTCTGTGCACTTCTCGAGAAGTGCACAGAAATAGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133215
VALIDATED
MTMR4 MISSION shRNA Bacterial Glycerol Stock
myotubularin related protein 4
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133215.1-4348s1c1
Sequence:CCGGCCAGTTATTCTGGGCTGTGAACTCGAGTTCACAGCCCAGAATAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133215.1-3196s1c1
Sequence:CCGGGCTTCAGATGAGGCTAGACATCTCGAGATGTCTAGCCTCATCTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133215.1-1076s1c1
Sequence:CCGGCCGAACTGTGAGGTCTTGTTTCTCGAGAAACAAGACCTCACAGTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133215.1-2742s1c1
Sequence:CCGGGCCAGATCAGTGAGTTCTCATCTCGAGATGAGAACTCACTGATCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133215.1-2857s21c1
Sequence:CCGGTAGCAAGAGGCCGAGCAATAACTCGAGTTATTGCTCGGCCTCTTGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133215.1-3260s21c1
Sequence:CCGGGAGGATGACTTTACGTGTTTACTCGAGTAAACACGTAAAGTCATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133215.1-805s21c1
Sequence:CCGGGCGCAATGCTGATGATGAATACTCGAGTATTCATCATCAGCATTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133215.1-296s1c1
Sequence:CCGGCGGATGATTGACAGTGTGGAACTCGAGTTCCACACTGTCAATCATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133215.1-3929s21c1
Sequence:CCGGAGGTCCCAAGATGATTCATAACTCGAGTTATGAATCATCTTGGGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133215.1-1343s21c1
Sequence:CCGGATACTACTGGATCCATATTACCTCGAGGTAATATGGATCCAGTAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133215.1-3978s21c1
Sequence:CCGGGCAATAGAAAGGCTTACTTATCTCGAGATAAGTAAGCCTTTCTATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133215
VALIDATED
MTMR4 MISSION shRNA shRNA Plasmid DNA
myotubularin related protein 4
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133215.1-4348s1c1
Sequence:CCGGCCAGTTATTCTGGGCTGTGAACTCGAGTTCACAGCCCAGAATAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133215.1-3196s1c1
Sequence:CCGGGCTTCAGATGAGGCTAGACATCTCGAGATGTCTAGCCTCATCTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133215.1-1076s1c1
Sequence:CCGGCCGAACTGTGAGGTCTTGTTTCTCGAGAAACAAGACCTCACAGTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133215.1-2742s1c1
Sequence:CCGGGCCAGATCAGTGAGTTCTCATCTCGAGATGAGAACTCACTGATCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133215.1-2857s21c1
Sequence:CCGGTAGCAAGAGGCCGAGCAATAACTCGAGTTATTGCTCGGCCTCTTGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133215.1-3260s21c1
Sequence:CCGGGAGGATGACTTTACGTGTTTACTCGAGTAAACACGTAAAGTCATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133215.1-805s21c1
Sequence:CCGGGCGCAATGCTGATGATGAATACTCGAGTATTCATCATCAGCATTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133215.1-296s1c1
Sequence:CCGGCGGATGATTGACAGTGTGGAACTCGAGTTCCACACTGTCAATCATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133215.1-3929s21c1
Sequence:CCGGAGGTCCCAAGATGATTCATAACTCGAGTTATGAATCATCTTGGGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133215.1-1343s21c1
Sequence:CCGGATACTACTGGATCCATATTACCTCGAGGTAATATGGATCCAGTAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133215.1-3978s21c1
Sequence:CCGGGCAATAGAAAGGCTTACTTATCTCGAGATAAGTAAGCCTTTCTATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133215
VALIDATED
MTMR4 MISSION shRNA Lentiviral Transduction Particles
myotubularin related protein 4
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133215.1-4348s1c1
Sequence:CCGGCCAGTTATTCTGGGCTGTGAACTCGAGTTCACAGCCCAGAATAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133215.1-3196s1c1
Sequence:CCGGGCTTCAGATGAGGCTAGACATCTCGAGATGTCTAGCCTCATCTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133215.1-1076s1c1
Sequence:CCGGCCGAACTGTGAGGTCTTGTTTCTCGAGAAACAAGACCTCACAGTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133215.1-2742s1c1
Sequence:CCGGGCCAGATCAGTGAGTTCTCATCTCGAGATGAGAACTCACTGATCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133215.1-2857s21c1
Sequence:CCGGTAGCAAGAGGCCGAGCAATAACTCGAGTTATTGCTCGGCCTCTTGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133215.1-3260s21c1
Sequence:CCGGGAGGATGACTTTACGTGTTTACTCGAGTAAACACGTAAAGTCATCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133215.1-805s21c1
Sequence:CCGGGCGCAATGCTGATGATGAATACTCGAGTATTCATCATCAGCATTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133215.1-296s1c1
Sequence:CCGGCGGATGATTGACAGTGTGGAACTCGAGTTCCACACTGTCAATCATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133215.1-3929s21c1
Sequence:CCGGAGGTCCCAAGATGATTCATAACTCGAGTTATGAATCATCTTGGGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133215.1-1343s21c1
Sequence:CCGGATACTACTGGATCCATATTACCTCGAGGTAATATGGATCCAGTAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133215.1-3978s21c1
Sequence:CCGGGCAATAGAAAGGCTTACTTATCTCGAGATAAGTAAGCCTTTCTATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)