EMAIL THIS PAGE TO A FRIEND

MTMR6

myotubularin related protein 6

98 Gene Product Result for
Gene ID:
Mouse(219135) myotubularin related protein 6
Rat(305935) myotubularin related protein 6
sheep(101116065) myotubularin related protein 6
naked mole-rat(101723145) myotubularin related protein 6
domestic guinea pig(100729293) myotubularin related protein 6
Zebrafish(327346) myotubularin related protein 6
dog(477336) myotubularin related protein 6
cow(540589) myotubularin related protein 6
Horse(100058883) myotubularin related protein 6
domestic cat(101085092) myotubularin related protein 6
chicken(418938) myotubularin related protein 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004685 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004685 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004685 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144843 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144843 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144843 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004685 siRNAs that have been validated in the lab human pricing
NM_001107268 Rosetta Predictions rat pricing
NM_144843 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004685 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053937 validated 767
1 SASI_Hs01_00053936 validated 882
1 SASI_Hs01_00053935 validated 1188
2 SASI_Hs01_00053938 predicted 2044
3 SASI_Hs02_00338119 predicted 487
4 SASI_Hs01_00053939 predicted 2168
5 SASI_Hs02_00338120 predicted 1518
6 SASI_Hs01_00053940 predicted 1382
7 SASI_Hs01_00053941 predicted 1798
8 SASI_Hs01_00053942 predicted 859
9 SASI_Hs01_00053943 predicted 994
10 SASI_Hs01_00053944 predicted 682
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107268 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227165 predicted 949
2 SASI_Rn02_00227166 predicted 382
3 SASI_Rn02_00227167 predicted 874
4 SASI_Rn02_00227168 predicted 589
5 SASI_Rn02_00227169 predicted 800
6 SASI_Rn02_00227170 predicted 561
7 SASI_Rn02_00227171 predicted 428
8 SASI_Rn02_00227172 predicted 247
9 SASI_Rn02_00227173 predicted 1125
10 SASI_Rn02_00227174 predicted 560
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144843 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059996 predicted 208
2 SASI_Mm01_00059997 predicted 1563
3 SASI_Mm01_00059998 predicted 361
4 SASI_Mm01_00060000 predicted 586
5 SASI_Mm01_00060002 predicted 1299
6 SASI_Mm01_00060003 predicted 472
7 SASI_Mm01_00060004 predicted 1465
8 SASI_Mm02_00340240 predicted 753
9 SASI_Mm02_00340241 predicted 557
10 SASI_Mm02_00340242 predicted 1054
11 SASI_Mm01_00059999 predicted 421
12 SASI_Mm01_00060001 predicted 807
13 SASI_Mm01_00060005 predicted 1997
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004685
VALIDATED
MTMR6 MISSION shRNA Bacterial Glycerol Stock
myotubularin related protein 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000355709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004685.3-412s21c1
Sequence:CCGGTACGGCTACACATCTATTATTCTCGAGAATAATAGATGTGTAGCCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004685.3-2086s21c1
Sequence:CCGGCCCGGCAGATAATCGTTATAGCTCGAGCTATAACGATTATCTGCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004685.3-2036s21c1
Sequence:CCGGCAGACTCTGCTACCCGTAAATCTCGAGATTTACGGGTAGCAGAGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004685.2-456s1c1
Sequence:CCGGCCTGGATATTACACCACCATACTCGAGTATGGTGGTGTAATATCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011055    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_004685.2-2669s1c1
Sequence:CCGGGCCTTAAATTCCCAGTGGATTCTCGAGAATCCACTGGGAATTTAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004685.2-582s1c1
Sequence:CCGGGCCATGATATTTACAACTCTTCTCGAGAAGAGTTGTAAATATCATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004685.3-1000s21c1
Sequence:CCGGCAATCCAGTCAATCGCTATATCTCGAGATATAGCGATTGACTGGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_004685.2-770s1c1
Sequence:CCGGCGGGACTACAAGATTTGTGAACTCGAGTTCACAAATCTTGTAGTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004685.2-1284s1c1
Sequence:CCGGCCAAAGCAATAACAGTTGAAACTCGAGTTTCAACTGTTATTGCTTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004685
VALIDATED
MTMR6 MISSION shRNA shRNA Plasmid DNA
myotubularin related protein 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000355709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004685.3-412s21c1
Sequence:CCGGTACGGCTACACATCTATTATTCTCGAGAATAATAGATGTGTAGCCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004685.3-2086s21c1
Sequence:CCGGCCCGGCAGATAATCGTTATAGCTCGAGCTATAACGATTATCTGCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004685.3-2036s21c1
Sequence:CCGGCAGACTCTGCTACCCGTAAATCTCGAGATTTACGGGTAGCAGAGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004685.2-456s1c1
Sequence:CCGGCCTGGATATTACACCACCATACTCGAGTATGGTGGTGTAATATCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011055    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_004685.2-2669s1c1
Sequence:CCGGGCCTTAAATTCCCAGTGGATTCTCGAGAATCCACTGGGAATTTAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004685.2-582s1c1
Sequence:CCGGGCCATGATATTTACAACTCTTCTCGAGAAGAGTTGTAAATATCATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004685.3-1000s21c1
Sequence:CCGGCAATCCAGTCAATCGCTATATCTCGAGATATAGCGATTGACTGGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_004685.2-770s1c1
Sequence:CCGGCGGGACTACAAGATTTGTGAACTCGAGTTCACAAATCTTGTAGTCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004685.2-1284s1c1
Sequence:CCGGCCAAAGCAATAACAGTTGAAACTCGAGTTTCAACTGTTATTGCTTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004685
VALIDATED
MTMR6 MISSION shRNA Lentiviral Transduction Particles
myotubularin related protein 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000355709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004685.3-412s21c1
Sequence:CCGGTACGGCTACACATCTATTATTCTCGAGAATAATAGATGTGTAGCCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004685.3-2086s21c1
Sequence:CCGGCCCGGCAGATAATCGTTATAGCTCGAGCTATAACGATTATCTGCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004685.3-2036s21c1
Sequence:CCGGCAGACTCTGCTACCCGTAAATCTCGAGATTTACGGGTAGCAGAGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004685.2-456s1c1
Sequence:CCGGCCTGGATATTACACCACCATACTCGAGTATGGTGGTGTAATATCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011055    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_004685.2-2669s1c1
Sequence:CCGGGCCTTAAATTCCCAGTGGATTCTCGAGAATCCACTGGGAATTTAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004685.2-582s1c1
Sequence:CCGGGCCATGATATTTACAACTCTTCTCGAGAAGAGTTGTAAATATCATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004685.3-1000s21c1
Sequence:CCGGCAATCCAGTCAATCGCTATATCTCGAGATATAGCGATTGACTGGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_004685.2-770s1c1
Sequence:CCGGCGGGACTACAAGATTTGTGAACTCGAGTTCACAAATCTTGTAGTCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004685.2-1284s1c1
Sequence:CCGGCCAAAGCAATAACAGTTGAAACTCGAGTTTCAACTGTTATTGCTTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144843
VALIDATED
MTMR6 MISSION shRNA Bacterial Glycerol Stock
myotubularin related protein 6
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144843.3-1391s21c1
Sequence:CCGGGCACATTCATTCATGCCAATTCTCGAGAATTGGCATGAATGAATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144843.3-247s21c1
Sequence:CCGGCCTGGATACTACACCACCATACTCGAGTATGGTGGTGTAGTATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144843.3-474s21c1
Sequence:CCGGCGGAATGGTTGGCAGCTTATTCTCGAGAATAAGCTGCCAACCATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144843.2-158s1c1
Sequence:CCGGCCGGTTTAGTACCAACAACAACTCGAGTTGTTGTTGGTACTAAACCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144843.2-247s1c1
Sequence:CCGGCCTGGATACTACACCACCATACTCGAGTATGGTGGTGTAGTATCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144843.2-474s1c1
Sequence:CCGGCGGAATGGTTGGCAGCTTATTCTCGAGAATAAGCTGCCAACCATTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144843.2-1391s1c1
Sequence:CCGGGCACATTCATTCATGCCAATTCTCGAGAATTGGCATGAATGAATGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144843.2-1074s1c1
Sequence:CCGGGCCAAAGCAATAGTGGTTGAACTCGAGTTCAACCACTATTGCTTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144843.3-1074s21c1
Sequence:CCGGGCCAAAGCAATAGTGGTTGAACTCGAGTTCAACCACTATTGCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144843
VALIDATED
MTMR6 MISSION shRNA shRNA Plasmid DNA
myotubularin related protein 6
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144843.3-1391s21c1
Sequence:CCGGGCACATTCATTCATGCCAATTCTCGAGAATTGGCATGAATGAATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144843.3-247s21c1
Sequence:CCGGCCTGGATACTACACCACCATACTCGAGTATGGTGGTGTAGTATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144843.3-474s21c1
Sequence:CCGGCGGAATGGTTGGCAGCTTATTCTCGAGAATAAGCTGCCAACCATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144843.2-158s1c1
Sequence:CCGGCCGGTTTAGTACCAACAACAACTCGAGTTGTTGTTGGTACTAAACCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144843.2-247s1c1
Sequence:CCGGCCTGGATACTACACCACCATACTCGAGTATGGTGGTGTAGTATCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144843.2-474s1c1
Sequence:CCGGCGGAATGGTTGGCAGCTTATTCTCGAGAATAAGCTGCCAACCATTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144843.2-1391s1c1
Sequence:CCGGGCACATTCATTCATGCCAATTCTCGAGAATTGGCATGAATGAATGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144843.2-1074s1c1
Sequence:CCGGGCCAAAGCAATAGTGGTTGAACTCGAGTTCAACCACTATTGCTTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144843.3-1074s21c1
Sequence:CCGGGCCAAAGCAATAGTGGTTGAACTCGAGTTCAACCACTATTGCTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144843
VALIDATED
MTMR6 MISSION shRNA Lentiviral Transduction Particles
myotubularin related protein 6
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144843.3-1391s21c1
Sequence:CCGGGCACATTCATTCATGCCAATTCTCGAGAATTGGCATGAATGAATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144843.3-247s21c1
Sequence:CCGGCCTGGATACTACACCACCATACTCGAGTATGGTGGTGTAGTATCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144843.3-474s21c1
Sequence:CCGGCGGAATGGTTGGCAGCTTATTCTCGAGAATAAGCTGCCAACCATTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144843.2-158s1c1
Sequence:CCGGCCGGTTTAGTACCAACAACAACTCGAGTTGTTGTTGGTACTAAACCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144843.2-247s1c1
Sequence:CCGGCCTGGATACTACACCACCATACTCGAGTATGGTGGTGTAGTATCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144843.2-474s1c1
Sequence:CCGGCGGAATGGTTGGCAGCTTATTCTCGAGAATAAGCTGCCAACCATTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144843.2-1391s1c1
Sequence:CCGGGCACATTCATTCATGCCAATTCTCGAGAATTGGCATGAATGAATGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144843.2-1074s1c1
Sequence:CCGGGCCAAAGCAATAGTGGTTGAACTCGAGTTCAACCACTATTGCTTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144843.3-1074s21c1
Sequence:CCGGGCCAAAGCAATAGTGGTTGAACTCGAGTTCAACCACTATTGCTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)