EMAIL THIS PAGE TO A FRIEND

MTMR7

myotubularin related protein 7

60 Gene Product Result for
UniProtKB ID: Q9Y216, A1L4K9, B4DG87, Q68DX4
Gene ID:
Human(9108) Summary: This gene encodes a member of the myotubularin family of tyrosine/dual-specificity phosphatases. The encoded protein is characterized by four distinct domains that are conserved among all members of the myotubularin family: the glucosyltransferase, Rab-like GTPase activator and myotubularins domain, the Rac-induced recruitment domain, the protein tyrosine phosphatases and dual-specificity phosphatases domain and the suppressor of variegation 3-9, enhancer-of-zeste, and trithorax interaction domain. This protein dephosphorylates the target substrates phosphatidylinositol 3-phosphate and inositol 1,3-bisphosphate. A pseudogene of this gene is found on chromosome 5. [provided by RefSeq, Mar 2009]
Mouse(54384) myotubularin related protein 7
Rat(306490) myotubularin related protein 7
chicken(422731) myotubularin related protein 7
cow(513986) myotubularin related protein 7
Horse(100053655) myotubularin related protein 7
domestic cat(101080528) myotubularin related protein 7
dog(475612) myotubularin related protein 7
domestic guinea pig(100733689) myotubularin related protein 7
naked mole-rat(101699227) myotubularin related protein 7
Domestic Rabbit(100339959) myotubularin related protein 7
sheep(101111072) myotubularin related protein 7
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019433 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019433 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019433 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004686 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004686 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004686 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004686 Rosetta Predictions human pricing
NM_001107312 Rosetta Predictions rat pricing
NM_001040699 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004686 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182930 predicted 1149
2 SASI_Hs02_00338121 predicted 1501
3 SASI_Hs01_00182931 predicted 1216
4 SASI_Hs01_00182932 predicted 209
5 SASI_Hs01_00182933 predicted 291
6 SASI_Hs01_00182934 predicted 2070
7 SASI_Hs01_00182935 predicted 1685
8 SASI_Hs01_00182936 predicted 1743
9 SASI_Hs01_00182937 predicted 2102
10 SASI_Hs01_00182938 predicted 2047
11 SASI_Hs01_00182939 predicted 585
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107312 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227595 predicted 1389
2 SASI_Rn02_00227596 predicted 1419
3 SASI_Rn02_00227597 predicted 1387
4 SASI_Rn02_00227598 predicted 405
5 SASI_Rn02_00227599 predicted 1361
6 SASI_Rn02_00227600 predicted 1225
7 SASI_Rn02_00227601 predicted 1349
8 SASI_Rn02_00227602 predicted 731
9 SASI_Rn02_00227603 predicted 1024
10 SASI_Rn02_00227604 predicted 1249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040699 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174921 predicted 1422
2 SASI_Mm01_00174922 predicted 1620
3 SASI_Mm01_00174923 predicted 227
4 SASI_Mm01_00174924 predicted 941
5 SASI_Mm01_00174925 predicted 1725
6 SASI_Mm02_00290364 predicted 281
7 SASI_Mm01_00174927 predicted 1088
8 SASI_Mm01_00174928 predicted 1340
9 SASI_Mm01_00174929 predicted 299
10 SASI_Mm02_00290365 predicted 1922
11 SASI_Mm01_00174926 predicted 1741
12 SASI_Mm01_00174930 predicted 1490
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019433
MTMR7 MISSION shRNA Bacterial Glycerol Stock
myotubularin related protein 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019433.1-641s1c1
Sequence:CCGGGCCCTTTCCTACTACTGTAAACTCGAGTTTACAGTAGTAGGAAAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019433.1-111s1c1
Sequence:CCGGGCTTGGTAGACAGAGTGTCTTCTCGAGAAGACACTCTGTCTACCAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019433.1-840s1c1
Sequence:CCGGGCTATGAGAATGAAGACAATTCTCGAGAATTGTCTTCATTCTCATAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019433.1-1262s1c1
Sequence:CCGGCCAGTAATCGACCAGTTCATTCTCGAGAATGAACTGGTCGATTACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019433.1-1153s1c1
Sequence:CCGGCCGGACTCTGAAAGGATTCATCTCGAGATGAATCCTTTCAGAGTCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019433
MTMR7 MISSION shRNA shRNA Plasmid DNA
myotubularin related protein 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019433.1-641s1c1
Sequence:CCGGGCCCTTTCCTACTACTGTAAACTCGAGTTTACAGTAGTAGGAAAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019433.1-111s1c1
Sequence:CCGGGCTTGGTAGACAGAGTGTCTTCTCGAGAAGACACTCTGTCTACCAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019433.1-840s1c1
Sequence:CCGGGCTATGAGAATGAAGACAATTCTCGAGAATTGTCTTCATTCTCATAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019433.1-1262s1c1
Sequence:CCGGCCAGTAATCGACCAGTTCATTCTCGAGAATGAACTGGTCGATTACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019433.1-1153s1c1
Sequence:CCGGCCGGACTCTGAAAGGATTCATCTCGAGATGAATCCTTTCAGAGTCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019433
MTMR7 MISSION shRNA Lentiviral Transduction Particles
myotubularin related protein 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019433.1-641s1c1
Sequence:CCGGGCCCTTTCCTACTACTGTAAACTCGAGTTTACAGTAGTAGGAAAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019433.1-111s1c1
Sequence:CCGGGCTTGGTAGACAGAGTGTCTTCTCGAGAAGACACTCTGTCTACCAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019433.1-840s1c1
Sequence:CCGGGCTATGAGAATGAAGACAATTCTCGAGAATTGTCTTCATTCTCATAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019433.1-1262s1c1
Sequence:CCGGCCAGTAATCGACCAGTTCATTCTCGAGAATGAACTGGTCGATTACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019433.1-1153s1c1
Sequence:CCGGCCGGACTCTGAAAGGATTCATCTCGAGATGAATCCTTTCAGAGTCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004686
MTMR7 MISSION shRNA Bacterial Glycerol Stock
myotubularin related protein 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004686.2-1988s1c1
Sequence:CCGGGATTCTGATGAAGCCGTGTTTCTCGAGAAACACGGCTTCATCAGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004686.2-2027s1c1
Sequence:CCGGCCTTTGGAGTTCCAAAGTAAACTCGAGTTTACTTTGGAACTCCAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004686.2-344s1c1
Sequence:CCGGCCAGTGAAATATGAGGAGTTACTCGAGTAACTCCTCATATTTCACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004686.2-1681s1c1
Sequence:CCGGCCAGTTAAATTGCACTAAGGTCTCGAGACCTTAGTGCAATTTAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004686.2-1774s1c1
Sequence:CCGGCCAGGATTACAGTGGGAATATCTCGAGATATTCCCACTGTAATCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004686.2-3581s1c1
Sequence:CCGGGCTGAGCAGTTCCCAAATTAACTCGAGTTAATTTGGGAACTGCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004686.2-728s1c1
Sequence:CCGGCCAGGAAGTGACTTCGTTTATCTCGAGATAAACGAAGTCACTTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004686.4-1327s21c1
Sequence:CCGGTGAAGGGCTTCATGGTATTAACTCGAGTTAATACCATGAAGCCCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004686.4-783s21c1
Sequence:CCGGTTCCGGAGTAGACGGCGATTTCTCGAGAAATCGCCGTCTACTCCGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004686.4-653s21c1
Sequence:CCGGGATGGGCCTCCCTAATCATTACTCGAGTAATGATTAGGGAGGCCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004686
MTMR7 MISSION shRNA shRNA Plasmid DNA
myotubularin related protein 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004686.2-1988s1c1
Sequence:CCGGGATTCTGATGAAGCCGTGTTTCTCGAGAAACACGGCTTCATCAGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004686.2-2027s1c1
Sequence:CCGGCCTTTGGAGTTCCAAAGTAAACTCGAGTTTACTTTGGAACTCCAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004686.2-344s1c1
Sequence:CCGGCCAGTGAAATATGAGGAGTTACTCGAGTAACTCCTCATATTTCACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004686.2-1681s1c1
Sequence:CCGGCCAGTTAAATTGCACTAAGGTCTCGAGACCTTAGTGCAATTTAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004686.2-1774s1c1
Sequence:CCGGCCAGGATTACAGTGGGAATATCTCGAGATATTCCCACTGTAATCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004686.2-3581s1c1
Sequence:CCGGGCTGAGCAGTTCCCAAATTAACTCGAGTTAATTTGGGAACTGCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004686.2-728s1c1
Sequence:CCGGCCAGGAAGTGACTTCGTTTATCTCGAGATAAACGAAGTCACTTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004686.4-1327s21c1
Sequence:CCGGTGAAGGGCTTCATGGTATTAACTCGAGTTAATACCATGAAGCCCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004686.4-783s21c1
Sequence:CCGGTTCCGGAGTAGACGGCGATTTCTCGAGAAATCGCCGTCTACTCCGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004686.4-653s21c1
Sequence:CCGGGATGGGCCTCCCTAATCATTACTCGAGTAATGATTAGGGAGGCCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004686
MTMR7 MISSION shRNA Lentiviral Transduction Particles
myotubularin related protein 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004686.2-1988s1c1
Sequence:CCGGGATTCTGATGAAGCCGTGTTTCTCGAGAAACACGGCTTCATCAGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004686.2-2027s1c1
Sequence:CCGGCCTTTGGAGTTCCAAAGTAAACTCGAGTTTACTTTGGAACTCCAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004686.2-344s1c1
Sequence:CCGGCCAGTGAAATATGAGGAGTTACTCGAGTAACTCCTCATATTTCACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004686.2-1681s1c1
Sequence:CCGGCCAGTTAAATTGCACTAAGGTCTCGAGACCTTAGTGCAATTTAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004686.2-1774s1c1
Sequence:CCGGCCAGGATTACAGTGGGAATATCTCGAGATATTCCCACTGTAATCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004686.2-3581s1c1
Sequence:CCGGGCTGAGCAGTTCCCAAATTAACTCGAGTTAATTTGGGAACTGCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004686.2-728s1c1
Sequence:CCGGCCAGGAAGTGACTTCGTTTATCTCGAGATAAACGAAGTCACTTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004686.4-1327s21c1
Sequence:CCGGTGAAGGGCTTCATGGTATTAACTCGAGTTAATACCATGAAGCCCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004686.4-783s21c1
Sequence:CCGGTTCCGGAGTAGACGGCGATTTCTCGAGAAATCGCCGTCTACTCCGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004686.4-653s21c1
Sequence:CCGGGATGGGCCTCCCTAATCATTACTCGAGTAATGATTAGGGAGGCCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)