EMAIL THIS PAGE TO A FRIEND

MTMR9

myotubularin related protein 9

139 Gene Product Result for
Synonyms: C8orf9 LIP-STYX MTMR8
UniProtKB ID: Q96QG7, Q52LU3, Q8WW11, Q96QG6, Q9NX50
Gene ID:
Human(66036) Summary: This gene encodes a myotubularin-related protein that is atypical to most other members of the myotubularin-related protein family because it has no dual-specificity phosphatase domain. The encoded protein contains a double-helical motif similar to the SET interaction domain, which is thought to have a role in the control of cell proliferation. In mouse, a protein similar to the encoded protein binds with MTMR7, and together they dephosphorylate phosphatidylinositol 3-phosphate and inositol 1,3-bisphosphate. [provided by RefSeq, Jul 2008]
Mouse(210376) myotubularin related protein 9
Rat(282584) myotubularin related protein 9
naked mole-rat(101705023) myotubularin related protein 9
Domestic Rabbit(100355823) myotubularin related protein 9
Domestic Rabbit(100358933) myotubularin related protein 9
domestic guinea pig(100714998) myotubularin related protein 9
sheep(101117905) myotubularin related protein 9
Zebrafish(565063) myotubularin related protein 9
cow(539174) myotubularin related protein 9
cow(521746) myotubularin related protein 9-like
Horse(100054675) myotubularin related protein 9
domestic cat(101083335) myotubularin related protein 9
dog(607147) myotubularin related protein 9
chicken(422033) myotubularin related protein 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015458 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015458 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015458 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177594 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177594 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177594 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015458 Rosetta Predictions human pricing
NM_001005761 Rosetta Predictions rat pricing
NM_177594 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015458 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244754 predicted 730
2 SASI_Hs02_00347870 predicted 1282
3 SASI_Hs02_00347871 predicted 1615
4 SASI_Hs01_00244755 predicted 1299
5 SASI_Hs01_00244756 predicted 1189
6 SASI_Hs01_00244757 predicted 1660
7 SASI_Hs01_00244758 predicted 1698
8 SASI_Hs01_00244759 predicted 2129
9 SASI_Hs01_00244760 predicted 1896
10 SASI_Hs01_00244761 predicted 1920
11 SASI_Hs01_00244762 predicted 1291
12 SASI_Hs01_00244763 predicted 1409
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005761 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121982 predicted 1382
2 SASI_Rn01_00121983 predicted 1042
3 SASI_Rn02_00198431 predicted 990
4 SASI_Rn01_00121986 predicted 459
5 SASI_Rn01_00121987 predicted 1751
6 SASI_Rn02_00198432 predicted 931
7 SASI_Rn01_00121988 predicted 1280
8 SASI_Rn02_00198433 predicted 558
9 SASI_Rn01_00121990 predicted 487
10 SASI_Rn01_00121991 predicted 454
11 SASI_Rn01_00121984 predicted 243
12 SASI_Rn01_00121985 predicted 978
13 SASI_Rn01_00121989 predicted 1515
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177594 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126393 predicted 1386
2 SASI_Mm01_00126394 predicted 1826
3 SASI_Mm01_00126395 predicted 1618
4 SASI_Mm01_00126396 predicted 1791
5 SASI_Mm01_00126397 predicted 563
6 SASI_Mm02_00347772 predicted 1942
7 SASI_Mm01_00126398 predicted 2012
8 SASI_Mm01_00126399 predicted 1713
9 SASI_Mm01_00126400 predicted 658
10 SASI_Mm01_00126401 predicted 1843
11 SASI_Mm01_00126402 predicted 488
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015458
VALIDATED
MTMR9 MISSION shRNA Bacterial Glycerol Stock
myotubularin related protein 9
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015458.3-5524s1c1
Sequence:CCGGCCGACCTTAATCTGGGATAAACTCGAGTTTATCCCAGATTAAGGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_015458.3-567s1c1
Sequence:CCGGGCCATCGACAAGCGATTTGTACTCGAGTACAAATCGCTTGTCGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_015458.3-738s1c1
Sequence:CCGGCGTCCTATGTTTGAAGTGATACTCGAGTATCACTTCAAACATAGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_015458.3-1689s1c1
Sequence:CCGGGCCTCACAGTTTGGAACATTTCTCGAGAAATGTTCCAAACTGTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015458.3-1090s1c1
Sequence:CCGGGCTACATCATTGACACCCGATCTCGAGATCGGGTGTCAATGATGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_015458.3-1366s21c1
Sequence:GTACCGGACAGGGAAGGAGCATCAATATCTCGAGATATTGATGCTCCTTCCCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_015458.3-567s21c1
Sequence:CCGGGCCATCGACAAGCGATTTGTACTCGAGTACAAATCGCTTGTCGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015458.3-1689s21c1
Sequence:CCGGGCCTCACAGTTTGGAACATTTCTCGAGAAATGTTCCAAACTGTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015458.3-950s21c1
Sequence:CCGGCTTCCCAGTACTAAGCTATTACTCGAGTAATAGCTTAGTACTGGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_015458.3-1274s21c1
Sequence:CCGGGGACCGATGGCTCAGTAAATTCTCGAGAATTTACTGAGCCATCGGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_015458.3-1198s21c1
Sequence:CCGGCCATTGAGAGGTATCACATTCCTCGAGGAATGTGATACCTCTCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015458
VALIDATED
MTMR9 MISSION shRNA shRNA Plasmid DNA
myotubularin related protein 9
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015458.3-5524s1c1
Sequence:CCGGCCGACCTTAATCTGGGATAAACTCGAGTTTATCCCAGATTAAGGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_015458.3-567s1c1
Sequence:CCGGGCCATCGACAAGCGATTTGTACTCGAGTACAAATCGCTTGTCGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_015458.3-738s1c1
Sequence:CCGGCGTCCTATGTTTGAAGTGATACTCGAGTATCACTTCAAACATAGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_015458.3-1689s1c1
Sequence:CCGGGCCTCACAGTTTGGAACATTTCTCGAGAAATGTTCCAAACTGTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015458.3-1090s1c1
Sequence:CCGGGCTACATCATTGACACCCGATCTCGAGATCGGGTGTCAATGATGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_015458.3-1366s21c1
Sequence:GTACCGGACAGGGAAGGAGCATCAATATCTCGAGATATTGATGCTCCTTCCCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_015458.3-567s21c1
Sequence:CCGGGCCATCGACAAGCGATTTGTACTCGAGTACAAATCGCTTGTCGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015458.3-1689s21c1
Sequence:CCGGGCCTCACAGTTTGGAACATTTCTCGAGAAATGTTCCAAACTGTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015458.3-950s21c1
Sequence:CCGGCTTCCCAGTACTAAGCTATTACTCGAGTAATAGCTTAGTACTGGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_015458.3-1274s21c1
Sequence:CCGGGGACCGATGGCTCAGTAAATTCTCGAGAATTTACTGAGCCATCGGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_015458.3-1198s21c1
Sequence:CCGGCCATTGAGAGGTATCACATTCCTCGAGGAATGTGATACCTCTCAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015458
VALIDATED
MTMR9 MISSION shRNA Lentiviral Transduction Particles
myotubularin related protein 9
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015458.3-5524s1c1
Sequence:CCGGCCGACCTTAATCTGGGATAAACTCGAGTTTATCCCAGATTAAGGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_015458.3-567s1c1
Sequence:CCGGGCCATCGACAAGCGATTTGTACTCGAGTACAAATCGCTTGTCGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_015458.3-738s1c1
Sequence:CCGGCGTCCTATGTTTGAAGTGATACTCGAGTATCACTTCAAACATAGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_015458.3-1689s1c1
Sequence:CCGGGCCTCACAGTTTGGAACATTTCTCGAGAAATGTTCCAAACTGTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015458.3-1090s1c1
Sequence:CCGGGCTACATCATTGACACCCGATCTCGAGATCGGGTGTCAATGATGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_015458.3-1366s21c1
Sequence:GTACCGGACAGGGAAGGAGCATCAATATCTCGAGATATTGATGCTCCTTCCCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_015458.3-567s21c1
Sequence:CCGGGCCATCGACAAGCGATTTGTACTCGAGTACAAATCGCTTGTCGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015458.3-1689s21c1
Sequence:CCGGGCCTCACAGTTTGGAACATTTCTCGAGAAATGTTCCAAACTGTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015458.3-950s21c1
Sequence:CCGGCTTCCCAGTACTAAGCTATTACTCGAGTAATAGCTTAGTACTGGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_015458.3-1274s21c1
Sequence:CCGGGGACCGATGGCTCAGTAAATTCTCGAGAATTTACTGAGCCATCGGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_015458.3-1198s21c1
Sequence:CCGGCCATTGAGAGGTATCACATTCCTCGAGGAATGTGATACCTCTCAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177594
VALIDATED
MTMR9 MISSION shRNA Bacterial Glycerol Stock
myotubularin related protein 9
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_177594.1-1548s1c1
Sequence:CCGGCCTTGCTCCTTCGAGTTTAATCTCGAGATTAAACTCGAAGGAGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_177594.1-543s1c1
Sequence:CCGGCGAATCATTCAGTTGGATATTCTCGAGAATATCCAACTGAATGATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_177594.1-1555s1c1
Sequence:CCGGCCTTCGAGTTTAATGAGCATTCTCGAGAATGCTCATTAAACTCGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_177594.1-657s1c1
Sequence:CCGGCCCATGTTTGAAGTGATTGAACTCGAGTTCAATCACTTCAAACATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_177594.1-2013s1c1
Sequence:CCGGCCCTCTGTTTGCCCTTCAATTCTCGAGAATTGAAGGGCAAACAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334207    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177594.1-2013s21c1
Sequence:CCGGCCCTCTGTTTGCCCTTCAATTCTCGAGAATTGAAGGGCAAACAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177594.1-1548s21c1
Sequence:CCGGCCTTGCTCCTTCGAGTTTAATCTCGAGATTAAACTCGAAGGAGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177594.1-657s21c1
Sequence:CCGGCCCATGTTTGAAGTGATTGAACTCGAGTTCAATCACTTCAAACATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177594.1-475s21c1
Sequence:CCGGATATCGACGCCATCGACAAACCTCGAGGTTTGTCGATGGCGTCGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177594
VALIDATED
MTMR9 MISSION shRNA shRNA Plasmid DNA
myotubularin related protein 9
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_177594.1-1548s1c1
Sequence:CCGGCCTTGCTCCTTCGAGTTTAATCTCGAGATTAAACTCGAAGGAGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_177594.1-543s1c1
Sequence:CCGGCGAATCATTCAGTTGGATATTCTCGAGAATATCCAACTGAATGATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_177594.1-1555s1c1
Sequence:CCGGCCTTCGAGTTTAATGAGCATTCTCGAGAATGCTCATTAAACTCGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_177594.1-657s1c1
Sequence:CCGGCCCATGTTTGAAGTGATTGAACTCGAGTTCAATCACTTCAAACATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_177594.1-2013s1c1
Sequence:CCGGCCCTCTGTTTGCCCTTCAATTCTCGAGAATTGAAGGGCAAACAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334207    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177594.1-2013s21c1
Sequence:CCGGCCCTCTGTTTGCCCTTCAATTCTCGAGAATTGAAGGGCAAACAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177594.1-1548s21c1
Sequence:CCGGCCTTGCTCCTTCGAGTTTAATCTCGAGATTAAACTCGAAGGAGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177594.1-657s21c1
Sequence:CCGGCCCATGTTTGAAGTGATTGAACTCGAGTTCAATCACTTCAAACATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177594.1-475s21c1
Sequence:CCGGATATCGACGCCATCGACAAACCTCGAGGTTTGTCGATGGCGTCGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177594
VALIDATED
MTMR9 MISSION shRNA Lentiviral Transduction Particles
myotubularin related protein 9
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_177594.1-1548s1c1
Sequence:CCGGCCTTGCTCCTTCGAGTTTAATCTCGAGATTAAACTCGAAGGAGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_177594.1-543s1c1
Sequence:CCGGCGAATCATTCAGTTGGATATTCTCGAGAATATCCAACTGAATGATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_177594.1-1555s1c1
Sequence:CCGGCCTTCGAGTTTAATGAGCATTCTCGAGAATGCTCATTAAACTCGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_177594.1-657s1c1
Sequence:CCGGCCCATGTTTGAAGTGATTGAACTCGAGTTCAATCACTTCAAACATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_177594.1-2013s1c1
Sequence:CCGGCCCTCTGTTTGCCCTTCAATTCTCGAGAATTGAAGGGCAAACAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334207    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177594.1-2013s21c1
Sequence:CCGGCCCTCTGTTTGCCCTTCAATTCTCGAGAATTGAAGGGCAAACAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177594.1-1548s21c1
Sequence:CCGGCCTTGCTCCTTCGAGTTTAATCTCGAGATTAAACTCGAAGGAGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177594.1-657s21c1
Sequence:CCGGCCCATGTTTGAAGTGATTGAACTCGAGTTCAATCACTTCAAACATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177594.1-475s21c1
Sequence:CCGGATATCGACGCCATCGACAAACCTCGAGGTTTGTCGATGGCGTCGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)