EMAIL THIS PAGE TO A FRIEND

MTMR9LP

myotubularin related protein 9-like, pseudogene

32 Gene Product Result for
Synonyms: MTMR9L
Gene ID:
chicken(419652) myotubularin related protein 9-like, pseudogene
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178546 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178546 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178546 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_040224 Rosetta Predictions human pricing
XR_040225 Rosetta Predictions human pricing
XR_040226 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040224 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517043 predicted 226
2 SASI_Hs02_00517044 predicted 196
3 SASI_Hs02_00517045 predicted 380
4 SASI_Hs02_00517046 predicted 482
5 SASI_Hs02_00517047 predicted 1069
6 SASI_Hs02_00517048 predicted 1427
7 SASI_Hs02_00517049 predicted 372
8 SASI_Hs02_00517050 predicted 1361
9 SASI_Hs02_00517051 predicted 764
10 SASI_Hs02_00517052 predicted 781
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040225 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517053 predicted 226
2 SASI_Hs02_00517054 predicted 203
3 SASI_Hs02_00517055 predicted 385
4 SASI_Hs02_00517056 predicted 475
5 SASI_Hs02_00517057 predicted 1075
6 SASI_Hs02_00517058 predicted 1423
7 SASI_Hs02_00517059 predicted 365
8 SASI_Hs02_00517060 predicted 1359
9 SASI_Hs02_00517061 predicted 771
10 SASI_Hs02_00517062 predicted 776
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040226 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517063 predicted 223
2 SASI_Hs02_00517064 predicted 196
3 SASI_Hs02_00517065 predicted 388
4 SASI_Hs02_00517066 predicted 477
5 SASI_Hs02_00517067 predicted 1069
6 SASI_Hs02_00517068 predicted 1427
7 SASI_Hs02_00517069 predicted 370
8 SASI_Hs02_00517070 predicted 1364
9 SASI_Hs02_00517071 predicted 766
10 SASI_Hs02_00517072 predicted 780
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178546
MTMR9LP MISSION shRNA Bacterial Glycerol Stock
myotubularin related protein 9-like, pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178546.2-418s1c1
Sequence:CCGGCGGAGCAAAGCATGGACAACTCTCGAGAGTTGTCCATGCTTTGCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178546.2-422s1c1
Sequence:CCGGGCAAAGCATGGACAACTGGCTCTCGAGAGCCAGTTGTCCATGCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178546.2-426s1c1
Sequence:CCGGAGCATGGACAACTGGCTGAGTCTCGAGACTCAGCCAGTTGTCCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178546.2-416s1c1
Sequence:CCGGCTCGGAGCAAAGCATGGACAACTCGAGTTGTCCATGCTTTGCTCCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113776    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178546.2-820s1c1
Sequence:CCGGGCAGCTGAGATGTTCCTGAAACTCGAGTTTCAGGAACATCTCAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178546
MTMR9LP MISSION shRNA shRNA Plasmid DNA
myotubularin related protein 9-like, pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178546.2-418s1c1
Sequence:CCGGCGGAGCAAAGCATGGACAACTCTCGAGAGTTGTCCATGCTTTGCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178546.2-422s1c1
Sequence:CCGGGCAAAGCATGGACAACTGGCTCTCGAGAGCCAGTTGTCCATGCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178546.2-426s1c1
Sequence:CCGGAGCATGGACAACTGGCTGAGTCTCGAGACTCAGCCAGTTGTCCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178546.2-416s1c1
Sequence:CCGGCTCGGAGCAAAGCATGGACAACTCGAGTTGTCCATGCTTTGCTCCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113776    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178546.2-820s1c1
Sequence:CCGGGCAGCTGAGATGTTCCTGAAACTCGAGTTTCAGGAACATCTCAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178546
MTMR9LP MISSION shRNA Lentiviral Transduction Particles
myotubularin related protein 9-like, pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178546.2-418s1c1
Sequence:CCGGCGGAGCAAAGCATGGACAACTCTCGAGAGTTGTCCATGCTTTGCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178546.2-422s1c1
Sequence:CCGGGCAAAGCATGGACAACTGGCTCTCGAGAGCCAGTTGTCCATGCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178546.2-426s1c1
Sequence:CCGGAGCATGGACAACTGGCTGAGTCTCGAGACTCAGCCAGTTGTCCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178546.2-416s1c1
Sequence:CCGGCTCGGAGCAAAGCATGGACAACTCGAGTTGTCCATGCTTTGCTCCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113776    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178546.2-820s1c1
Sequence:CCGGGCAGCTGAGATGTTCCTGAAACTCGAGTTTCAGGAACATCTCAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)