EMAIL THIS PAGE TO A FRIEND

MTNR1A

melatonin receptor 1A

68 Gene Product Result for
Synonyms: MEL-1A-R MT1
UniProtKB ID: P48039, A0AVC5, B0M0L2
Gene ID:
Human(4543) Summary: This gene encodes one of two high affinity forms of a receptor for melatonin, the primary hormone secreted by the pineal gland. This receptor is a G-protein coupled, 7-transmembrane receptor that is responsible for melatonin effects on mammalian circadian rhythm and reproductive alterations affected by day length. The receptor is an integral membrane protein that is readily detectable and localized to two specific regions of the brain. The hypothalamic suprachiasmatic nucleus appears to be involved in circadian rhythm while the hypophysial pars tuberalis may be responsible for the reproductive effects of melatonin. [provided by RefSeq, Jul 2008]
Mouse(17773) melatonin receptor 1A
Rat(114211) melatonin receptor 1A
chicken(396319) melatonin receptor 1A
cow(539948) melatonin receptor 1A
domestic cat(101098297) melatonin receptor 1A
dog(482904) melatonin receptor 1A
sheep(443022) melatonin receptor 1A
domestic guinea pig(100720785) melatonin receptor 1A
naked mole-rat(101719975) melatonin receptor 1A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
H0627 6-Hydroxymelatonin human pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
K1888 K 185 solid human pricing
L2407 Luzindole ≥90% human pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
M5250 Melatonin powder, ≥98% (TLC) human pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
I5531 IIK7 solid human pricing
A7342 N-Acetyltryptamine powder human pricing

Small Molecule - Precursor

Product # Description Species Add to Cart
 
A1824 N-Acetyl-5-hydroxytryptamine ≥99% (TLC), powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008639 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008639 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008639 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005958 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005958 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005958 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU012821 MISSION® esiRNA esiRNA targeting human MTNR1A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005958 Rosetta Predictions human pricing
XM_001061841 Rosetta Predictions rat pricing
XM_341441 Rosetta Predictions rat pricing
NM_008639 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005958 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161521 predicted 673
2 SASI_Hs01_00161522 predicted 409
3 SASI_Hs01_00161523 predicted 688
4 SASI_Hs01_00161525 predicted 853
5 SASI_Hs01_00161526 predicted 850
6 SASI_Hs01_00161527 predicted 293
7 SASI_Hs01_00161528 predicted 246
8 SASI_Hs01_00161529 predicted 408
9 SASI_Hs01_00161530 predicted 260
10 SASI_Hs02_00340622 predicted 842
11 SASI_Hs01_00161524 predicted 734
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061841 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00301473 predicted 709
2 SASI_Rn02_00301474 predicted 367
3 SASI_Rn02_00301475 predicted 403
4 SASI_Rn02_00301476 predicted 238
5 SASI_Rn02_00301477 predicted 778
6 SASI_Rn02_00301478 predicted 517
7 SASI_Rn02_00301479 predicted 404
8 SASI_Rn02_00301480 predicted 387
9 SASI_Rn02_00301481 predicted 604
10 SASI_Rn02_00301482 predicted 625
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341441 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392932 predicted 705
2 SASI_Rn02_00392933 predicted 365
3 SASI_Rn02_00392934 predicted 398
4 SASI_Rn02_00392935 predicted 244
5 SASI_Rn02_00392936 predicted 781
6 SASI_Rn02_00392937 predicted 525
7 SASI_Rn02_00392938 predicted 403
8 SASI_Rn02_00392939 predicted 385
9 SASI_Rn02_00392940 predicted 603
10 SASI_Rn02_00392941 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008639 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148765 predicted 840
2 SASI_Mm01_00148766 predicted 705
3 SASI_Mm01_00148767 predicted 524
4 SASI_Mm01_00148768 predicted 1020
5 SASI_Mm01_00148769 predicted 299
6 SASI_Mm01_00148771 predicted 982
7 SASI_Mm01_00148772 predicted 603
8 SASI_Mm02_00314362 predicted 964
9 SASI_Mm01_00148773 predicted 289
10 SASI_Mm01_00148774 predicted 1138
11 SASI_Mm01_00148770 predicted 379
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008639
MTNR1A MISSION shRNA Bacterial Glycerol Stock
melatonin receptor 1A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008639.1-766s1c1
Sequence:CCGGCCACTCAACCTCATAGGTCTTCTCGAGAAGACCTATGAGGTTGAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008639.1-600s1c1
Sequence:CCGGCGTGCCTATGATTATTGTCATCTCGAGATGACAATAATCATAGGCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008639.1-872s1c1
Sequence:CCGGGCTGCCTCAACGCAATTATATCTCGAGATATAATTGCGTTGAGGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008639.1-1012s1c1
Sequence:CCGGCCCTCTCCACTAATACCCAATCTCGAGATTGGGTATTAGTGGAGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008639.1-261s1c1
Sequence:CCGGGCTGACATCTATCCTTAACAACTCGAGTTGTTAAGGATAGATGTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008639
MTNR1A MISSION shRNA shRNA Plasmid DNA
melatonin receptor 1A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008639.1-766s1c1
Sequence:CCGGCCACTCAACCTCATAGGTCTTCTCGAGAAGACCTATGAGGTTGAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008639.1-600s1c1
Sequence:CCGGCGTGCCTATGATTATTGTCATCTCGAGATGACAATAATCATAGGCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008639.1-872s1c1
Sequence:CCGGGCTGCCTCAACGCAATTATATCTCGAGATATAATTGCGTTGAGGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008639.1-1012s1c1
Sequence:CCGGCCCTCTCCACTAATACCCAATCTCGAGATTGGGTATTAGTGGAGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008639.1-261s1c1
Sequence:CCGGGCTGACATCTATCCTTAACAACTCGAGTTGTTAAGGATAGATGTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008639
MTNR1A MISSION shRNA Lentiviral Transduction Particles
melatonin receptor 1A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008639.1-766s1c1
Sequence:CCGGCCACTCAACCTCATAGGTCTTCTCGAGAAGACCTATGAGGTTGAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008639.1-600s1c1
Sequence:CCGGCGTGCCTATGATTATTGTCATCTCGAGATGACAATAATCATAGGCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008639.1-872s1c1
Sequence:CCGGGCTGCCTCAACGCAATTATATCTCGAGATATAATTGCGTTGAGGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008639.1-1012s1c1
Sequence:CCGGCCCTCTCCACTAATACCCAATCTCGAGATTGGGTATTAGTGGAGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008639.1-261s1c1
Sequence:CCGGGCTGACATCTATCCTTAACAACTCGAGTTGTTAAGGATAGATGTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005958
MTNR1A MISSION shRNA Bacterial Glycerol Stock
melatonin receptor 1A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005958.2-1087s1c1
Sequence:CCGGCCACTGATGACCAACAATAATCTCGAGATTATTGTTGGTCATCAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005958.2-1564s1c1
Sequence:CCGGGCCTCTTATTACAGAGGGAAACTCGAGTTTCCCTCTGTAATAAGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005958.3-265s21c1
Sequence:CCGGTTGGTGCTGATGTCGATATTTCTCGAGAAATATCGACATCAGCACCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005958.2-330s1c1
Sequence:CCGGGCTGATGTCGATATTTAACAACTCGAGTTGTTAAATATCGACATCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005958.2-941s1c1
Sequence:CCGGGCTGCCTCAATGCCATTATATCTCGAGATATAATGGCATTGAGGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005958.2-913s1c1
Sequence:CCGGGCCAGTTACTACATGGCGTATCTCGAGATACGCCATGTAGTAACTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005958.3-856s21c1
Sequence:CCGGAGTTACTACATGGCGTATTTCCTCGAGGAAATACGCCATGTAGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005958.3-346s21c1
Sequence:CCGGAGCGTCATCGGCTCCATATTCCTCGAGGAATATGGAGCCGATGACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005958
MTNR1A MISSION shRNA shRNA Plasmid DNA
melatonin receptor 1A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005958.2-1087s1c1
Sequence:CCGGCCACTGATGACCAACAATAATCTCGAGATTATTGTTGGTCATCAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005958.2-1564s1c1
Sequence:CCGGGCCTCTTATTACAGAGGGAAACTCGAGTTTCCCTCTGTAATAAGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005958.3-265s21c1
Sequence:CCGGTTGGTGCTGATGTCGATATTTCTCGAGAAATATCGACATCAGCACCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005958.2-330s1c1
Sequence:CCGGGCTGATGTCGATATTTAACAACTCGAGTTGTTAAATATCGACATCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005958.2-941s1c1
Sequence:CCGGGCTGCCTCAATGCCATTATATCTCGAGATATAATGGCATTGAGGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005958.2-913s1c1
Sequence:CCGGGCCAGTTACTACATGGCGTATCTCGAGATACGCCATGTAGTAACTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005958.3-856s21c1
Sequence:CCGGAGTTACTACATGGCGTATTTCCTCGAGGAAATACGCCATGTAGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005958.3-346s21c1
Sequence:CCGGAGCGTCATCGGCTCCATATTCCTCGAGGAATATGGAGCCGATGACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005958
MTNR1A MISSION shRNA Lentiviral Transduction Particles
melatonin receptor 1A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005958.2-1087s1c1
Sequence:CCGGCCACTGATGACCAACAATAATCTCGAGATTATTGTTGGTCATCAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005958.2-1564s1c1
Sequence:CCGGGCCTCTTATTACAGAGGGAAACTCGAGTTTCCCTCTGTAATAAGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005958.3-265s21c1
Sequence:CCGGTTGGTGCTGATGTCGATATTTCTCGAGAAATATCGACATCAGCACCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005958.2-330s1c1
Sequence:CCGGGCTGATGTCGATATTTAACAACTCGAGTTGTTAAATATCGACATCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005958.2-941s1c1
Sequence:CCGGGCTGCCTCAATGCCATTATATCTCGAGATATAATGGCATTGAGGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005958.2-913s1c1
Sequence:CCGGGCCAGTTACTACATGGCGTATCTCGAGATACGCCATGTAGTAACTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005958.3-856s21c1
Sequence:CCGGAGTTACTACATGGCGTATTTCCTCGAGGAAATACGCCATGTAGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005958.3-346s21c1
Sequence:CCGGAGCGTCATCGGCTCCATATTCCTCGAGGAATATGGAGCCGATGACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)