EMAIL THIS PAGE TO A FRIEND

MTNR1B

melatonin receptor 1B

71 Gene Product Result for
Synonyms: FGQTL2 MEL-1B-R MT2
UniProtKB ID: P49286
Gene ID:
Human(4544) Summary: This gene encodes one of two high affinity forms of a receptor for melatonin, the primary hormone secreted by the pineal gland. This gene product is an integral membrane protein that is a G-protein coupled, 7-transmembrane receptor. It is found primarily in the retina and brain although this detection requires RT-PCR. It is thought to participate in light-dependent functions in the retina and may be involved in the neurobiological effects of melatonin. [provided by RefSeq, Jul 2008]
Mouse(244701) melatonin receptor 1B
Rat(192646) melatonin receptor 1B
chicken(396338) melatonin receptor 1B
domestic cat(101083701) melatonin receptor 1B
cow(528665) melatonin receptor 1B
Horse(100059172) melatonin receptor 1B
dog(607818) melatonin receptor 1B
naked mole-rat(101702954) melatonin receptor 1B
domestic guinea pig(100724092) melatonin receptor 1B
sheep(100174786) melatonin receptor 1B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
H0627 6-Hydroxymelatonin human pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
K1888 K 185 solid human pricing
L2407 Luzindole ≥90% human pricing
M5250 Melatonin powder, ≥98% (TLC) human pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
I5531 IIK7 solid human pricing
A7342 N-Acetyltryptamine powder human pricing

Small Molecule - Precursor

Product # Description Species Add to Cart
 
A1824 N-Acetyl-5-hydroxytryptamine ≥99% (TLC), powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005959 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005959 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005959 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145712 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145712 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145712 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005959 Rosetta Predictions human pricing
XM_001074702 Rosetta Predictions rat pricing
XM_345899 Rosetta Predictions rat pricing
NM_145712 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005959 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078810 predicted 317
2 SASI_Hs01_00078811 predicted 734
3 SASI_Hs01_00078812 predicted 1151
4 SASI_Hs01_00078813 predicted 973
5 SASI_Hs01_00078814 predicted 442
6 SASI_Hs01_00078815 predicted 831
7 SASI_Hs02_00340623 predicted 777
8 SASI_Hs01_00078817 predicted 1277
9 SASI_Hs01_00078818 predicted 431
10 SASI_Hs01_00078819 predicted 1174
11 SASI_Hs01_00078816 predicted 1204
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074702 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00347065 predicted 625
2 SASI_Rn02_00347066 predicted 215
3 SASI_Rn02_00347067 predicted 337
4 SASI_Rn02_00347068 predicted 410
5 SASI_Rn02_00347069 predicted 361
6 SASI_Rn02_00347070 predicted 554
7 SASI_Rn02_00347071 predicted 245
8 SASI_Rn02_00347072 predicted 333
9 SASI_Rn02_00347073 predicted 252
10 SASI_Rn02_00347074 predicted 268
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345899 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398842 predicted 209
2 SASI_Rn02_00398843 predicted 202
3 SASI_Rn02_00398844 predicted 217
4 SASI_Rn02_00398845 predicted 246
5 SASI_Rn02_00398846 predicted 205
6 SASI_Rn02_00398847 predicted 266
7 SASI_Rn02_00398848 predicted 272
8 SASI_Rn02_00398849 predicted 208
9 SASI_Rn02_00398850 predicted 200
10 SASI_Rn02_00398851 predicted 205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145712 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053600 predicted 412
2 SASI_Mm01_00053601 predicted 255
3 SASI_Mm01_00053602 predicted 456
4 SASI_Mm01_00053603 predicted 341
5 SASI_Mm01_00053604 predicted 449
6 SASI_Mm01_00053606 predicted 213
7 SASI_Mm01_00053607 predicted 738
8 SASI_Mm01_00053608 predicted 277
9 SASI_Mm01_00053609 predicted 295
10 SASI_Mm02_00341264 predicted 553
11 SASI_Mm01_00053605 predicted 363
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005959
MTNR1B MISSION shRNA Bacterial Glycerol Stock
melatonin receptor 1B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005959.3-313s21c1
Sequence:CCGGGCTCCGGAACGCAGGTAATTTCTCGAGAAATTACCTGCGTTCCGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005959.3-648s21c1
Sequence:CCGGAGTACGACCCACGCATCTATTCTCGAGAATAGATGCGTGGGTCGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005959.3-492s21c1
Sequence:CCGGATATCACTGCCATCGCCATTACTCGAGTAATGGCGATGGCAGTGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009187    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005959.2-1210s1c1
Sequence:CCGGCCAGCAGCATGACAAACTCATCTCGAGATGAGTTTGTCATGCTGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005959.2-978s1c1
Sequence:CCGGCTAGCTACTTACTGGCTTATTCTCGAGAATAAGCCAGTAAGTAGCTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005959.2-854s1c1
Sequence:CCGGCTAACCATGTTTGTGGTGTTTCTCGAGAAACACCACAAACATGGTTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005959.2-319s1c1
Sequence:CCGGGAACGCAGGTAATTTGTTCTTCTCGAGAAGAACAAATTACCTGCGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005959.2-845s1c1
Sequence:CCGGCGGAGCTTTCTAACCATGTTTCTCGAGAAACATGGTTAGAAAGCTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005959
MTNR1B MISSION shRNA shRNA Plasmid DNA
melatonin receptor 1B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005959.3-313s21c1
Sequence:CCGGGCTCCGGAACGCAGGTAATTTCTCGAGAAATTACCTGCGTTCCGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005959.3-648s21c1
Sequence:CCGGAGTACGACCCACGCATCTATTCTCGAGAATAGATGCGTGGGTCGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005959.3-492s21c1
Sequence:CCGGATATCACTGCCATCGCCATTACTCGAGTAATGGCGATGGCAGTGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009187    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005959.2-1210s1c1
Sequence:CCGGCCAGCAGCATGACAAACTCATCTCGAGATGAGTTTGTCATGCTGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005959.2-978s1c1
Sequence:CCGGCTAGCTACTTACTGGCTTATTCTCGAGAATAAGCCAGTAAGTAGCTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005959.2-854s1c1
Sequence:CCGGCTAACCATGTTTGTGGTGTTTCTCGAGAAACACCACAAACATGGTTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005959.2-319s1c1
Sequence:CCGGGAACGCAGGTAATTTGTTCTTCTCGAGAAGAACAAATTACCTGCGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005959.2-845s1c1
Sequence:CCGGCGGAGCTTTCTAACCATGTTTCTCGAGAAACATGGTTAGAAAGCTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005959
MTNR1B MISSION shRNA Lentiviral Transduction Particles
melatonin receptor 1B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005959.3-313s21c1
Sequence:CCGGGCTCCGGAACGCAGGTAATTTCTCGAGAAATTACCTGCGTTCCGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005959.3-648s21c1
Sequence:CCGGAGTACGACCCACGCATCTATTCTCGAGAATAGATGCGTGGGTCGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005959.3-492s21c1
Sequence:CCGGATATCACTGCCATCGCCATTACTCGAGTAATGGCGATGGCAGTGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009187    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005959.2-1210s1c1
Sequence:CCGGCCAGCAGCATGACAAACTCATCTCGAGATGAGTTTGTCATGCTGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005959.2-978s1c1
Sequence:CCGGCTAGCTACTTACTGGCTTATTCTCGAGAATAAGCCAGTAAGTAGCTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005959.2-854s1c1
Sequence:CCGGCTAACCATGTTTGTGGTGTTTCTCGAGAAACACCACAAACATGGTTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005959.2-319s1c1
Sequence:CCGGGAACGCAGGTAATTTGTTCTTCTCGAGAAGAACAAATTACCTGCGTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005959.2-845s1c1
Sequence:CCGGCGGAGCTTTCTAACCATGTTTCTCGAGAAACATGGTTAGAAAGCTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145712
MTNR1B MISSION shRNA Bacterial Glycerol Stock
melatonin receptor 1B
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000025775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145712.1-750s1c1
Sequence:CCGGCCTAACCATGTTTGCAGTGTTCTCGAGAACACTGCAAACATGGTTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145712.1-423s1c1
Sequence:CCGGCATCTGTCATAGTACCACCTACTCGAGTAGGTGGTACTATGACAGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145712.1-118s1c1
Sequence:CCGGGCTCCCATGCTATCTACAGTACTCGAGTACTGTAGATAGCATGGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145712.1-742s1c1
Sequence:CCGGCGCAGTTTCCTAACCATGTTTCTCGAGAAACATGGTTAGGAAACTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145712
MTNR1B MISSION shRNA shRNA Plasmid DNA
melatonin receptor 1B
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000025775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145712.1-750s1c1
Sequence:CCGGCCTAACCATGTTTGCAGTGTTCTCGAGAACACTGCAAACATGGTTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145712.1-423s1c1
Sequence:CCGGCATCTGTCATAGTACCACCTACTCGAGTAGGTGGTACTATGACAGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145712.1-118s1c1
Sequence:CCGGGCTCCCATGCTATCTACAGTACTCGAGTACTGTAGATAGCATGGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145712.1-742s1c1
Sequence:CCGGCGCAGTTTCCTAACCATGTTTCTCGAGAAACATGGTTAGGAAACTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145712
MTNR1B MISSION shRNA Lentiviral Transduction Particles
melatonin receptor 1B
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000025775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145712.1-750s1c1
Sequence:CCGGCCTAACCATGTTTGCAGTGTTCTCGAGAACACTGCAAACATGGTTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145712.1-423s1c1
Sequence:CCGGCATCTGTCATAGTACCACCTACTCGAGTAGGTGGTACTATGACAGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145712.1-118s1c1
Sequence:CCGGGCTCCCATGCTATCTACAGTACTCGAGTACTGTAGATAGCATGGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145712.1-742s1c1
Sequence:CCGGCGCAGTTTCCTAACCATGTTTCTCGAGAAACATGGTTAGGAAACTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)