EMAIL THIS PAGE TO A FRIEND

MTOR

mechanistic target of rapamycin (serine/threonine kinase)

130 Gene Product Result for
Synonyms: FRAP FRAP1 FRAP2 RAFT1 RAPT1
UniProtKB ID: P42345, Q4LE76, Q5TER1, Q6LE87, Q96QG3, Q9Y4I3
Gene ID:
Human(2475) Summary: The protein encoded by this gene belongs to a family of phosphatidylinositol kinase-related kinases. These kinases mediate cellular responses to stresses such as DNA damage and nutrient deprivation. This protein acts as the target for the cell-cycle arrest and immunosuppressive effects of the FKBP12-rapamycin complex. The ANGPTL7 gene is located in an intron of this gene. [provided by RefSeq, Sep 2008]
Mouse(56717) mechanistic target of rapamycin (serine/threonine kinase)
Rat(56718) mechanistic target of rapamycin (serine/threonine kinase)
Zebrafish(324254) mechanistic target of rapamycin (serine/threonine kinase)
cow(100139219) mechanistic target of rapamycin (serine/threonine kinase)
Horse(100051341) mechanistic target of rapamycin (serine/threonine kinase)
domestic cat(101098152) mechanistic target of rapamycin (serine/threonine kinase)
dog(478232) mechanistic target of rapamycin (serine/threonine kinase)
chicken(419455) mechanistic target of rapamycin (serine/threonine kinase)
Domestic Rabbit(100356164) mechanistic target of rapamycin (serine/threonine kinase)
naked mole-rat(101725626) mechanistic target of rapamycin (serine/threonine kinase)
domestic guinea pig(100724938) mechanistic target of rapamycin (serine/threonine kinase)
Goat(100860902) mechanistic target of rapamycin (serine/threonine kinase)
sheep(100271659) mechanistic target of rapamycin (serine/threonine kinase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300473 Anti-FRAP1 (Ab-2448) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300583 Anti-FRAP1 (Ab-2481) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunohistochemistry pricing
SAB2701842 Anti-mtor antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
SAB2701843 Anti-mtor antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
T2949 Anti-mTOR antibody produced in rabbit 1.0-1.5 mg/mL, affinity isolated antibody, buffered aqueous solution rat, human, mouse
immunoprecipitation (IP), microarray, western blot pricing
SAB4501038 Anti-MTOR antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4501039 Anti-MTOR antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4501040 Anti-MTOR antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
HPA071227 Anti-MTOR antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB4300178 Anti-phospho-FRAP1 (pSer2448) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB4504476 Anti-phospho-mTOR (pSer2448) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504043 Anti-phospho-mTOR (pSer2481) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry pricing
SAB4301526 Anti-phospho-mTOR (pSer2481) antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
SAB4504282 Anti-phospho-mTOR (pThr2446) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4301415 Anti-phospho-mTOR (pThr2446) antibody produced in rabbit affinity isolated antibody rat, mouse, human
western blot pricing
PRS3485 Anti-TOR antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, immunocytochemistry, western blot pricing
WH0002475M1 Monoclonal Anti-FRAP1 antibody produced in mouse clone 2C5, purified immunoglobulin, buffered aqueous solution human
ELISA, proximity ligation assay pricing
SAB2702296 Monoclonal Anti-mTOR antibody produced in mouse clone GT649, affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing
SAB2702297 Monoclonal Anti-mTOR antibody produced in mouse clone GT6611, affinity isolated antibody human
immunofluorescence, western blot pricing
SAB2702298 Monoclonal Anti-mTOR antibody produced in mouse clone GT778, affinity isolated antibody human
western blot pricing
PLA0114 Rabbit anti-mTOR Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. horse, rabbit, sheep, rhesus monkey, mouse, goat, dog, human, bovine, pig, rat, guinea pig
immunofluorescence, immunoprecipitation (IP), proximity ligation assay pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004958 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004958 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004958 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020009 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020009 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020009 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
05-1592 Anti-mTOR Antibody, clone 2ID8.2 Anti-mTOR Antibody, clone 2ID8.2 is an antibody against mTOR for use in WB & IC. pricing
MABS14 Anti-mTOR Antibody, clone F11 This Anti-mTOR Antibody, clone F11 is validated for use in WB, IP for the detection of mTOR. pricing
MABS196 Anti-mTOR/FRAP Antibody, clone 22C2 Detect the mTOR/FRAP protein using this Anti-mTOR Antibody, clone 22C2, validated for use in WB & IP. pricing
MABS799 Anti-mTOR/FRAP, clone EPR390(N), Rabbit Monoclonal Antibody This Anti-mTOR antibody is validated for use in Western Blotting for the detection of mTOR/FRAP. pricing
ABS79 Anti-phospho-mTOR (Ser2159) Antibody Anti-mTOR Antibody detects level of phospho-mTOR (Ser2159) & has been published & validated for use in Western Blotting, Peptide Inhibition Assay, Dot Blot. pricing
09-213 Anti-phospho-mTOR (Ser2448) Antibody This Anti-mTOR Antibody is validated for use in WB for the detection of phospho-mTOR (Ser2448). pricing
09-343 Anti-phospho-mTOR (Ser2481) Antibody Detect phospho-mTOR (Ser2481) using this Anti-mTOR Antibody validated for use in WB. pricing
ABS88 Anti-phospho-mTOR (Thr2164) Antibody Anti-mTOR Antibody is an antibody against phospho-mTOR (Thr2164) for use in Dot Blot, Western Blotting. pricing
09-345 Anti-phospho-mTOR (Thr2446) Antibody Anti-mTOR Antibody detects level of phospho-mTOR (Thr2446) & has been published & validated for use in WB. pricing
14-770-M mTOR (1362-end) Protein, active, 10 µg Active, N-terminal FLAG-tagged, recombinant, human mTOR, amino acids 1362-end, for use in Kinase Assays. pricing
15-105 mTOR phosphorylation Pathway Explorer Antibody MiniPack This Antibody pack contains Anti-phospho-mTOR Antibody(Ser2481), Anti-phospho-mTOR Antibody (Thr2446), Anti-phospho-mTOR (Ser2448). pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004958 siRNAs that have been validated in the lab human pricing
NM_019906 Rosetta Predictions rat pricing
NM_020009 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004958 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203145 validated 2865
1 SASI_Hs01_00203144 validated 2397
1 SASI_Hs01_00203146 validated 3299
2 SASI_Hs02_00338641 predicted 4813
3 SASI_Hs01_00203147 predicted 1333
4 SASI_Hs02_00338642 predicted 3222
5 SASI_Hs01_00203148 predicted 5875
6 SASI_Hs01_00203149 predicted 5108
7 SASI_Hs01_00203150 predicted 1463
8 SASI_Hs01_00203152 predicted 3678
9 SASI_Hs01_00203151 predicted 7129
10 SASI_Hs01_00203153 predicted 2854
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019906 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066688 predicted 2381
2 SASI_Rn01_00066689 predicted 4365
3 SASI_Rn01_00066690 predicted 2824
4 SASI_Rn01_00066691 predicted 6723
5 SASI_Rn01_00066693 predicted 5728
6 SASI_Rn01_00066694 predicted 3661
7 SASI_Rn02_00262441 predicted 7770
8 SASI_Rn01_00066696 predicted 3693
9 SASI_Rn02_00262442 predicted 6299
10 SASI_Rn02_00262443 predicted 3509
11 SASI_Rn01_00066692 predicted 1813
12 SASI_Rn01_00066695 predicted 4352
13 SASI_Rn01_00066697 predicted 6596
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020009 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164492 predicted 3698
2 SASI_Mm01_00164493 predicted 3536
3 SASI_Mm01_00164494 predicted 7146
4 SASI_Mm01_00164495 predicted 5411
5 SASI_Mm01_00164496 predicted 3320
6 SASI_Mm01_00164497 predicted 5101
7 SASI_Mm01_00164498 predicted 5741
8 SASI_Mm01_00164499 predicted 3722
9 SASI_Mm02_00325378 predicted 6308
10 SASI_Mm01_00164500 predicted 2640
11 SASI_Mm01_00164491 predicted 7409
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004958
VALIDATED
MTOR MISSION shRNA Bacterial Glycerol Stock
mechanistic target of rapamycin (serine/threonine kinase)
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004958.3-682s21c1
Sequence:CCGGGCAACCCTTCTTTGACAACATCTCGAGATGTTGTCAAAGAAGGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004958.3-5519s21c1
Sequence:CCGGGCTGTGCTACACTACAAACATCTCGAGATGTTTGTAGTGTAGCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004958.3-2204s21c1
Sequence:CCGGGCCTTGTTTGTGGCTCTGAATCTCGAGATTCAGAGCCACAAACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004958.3-3579s21c1
Sequence:CCGGCCCGGATCATTCACCCTATTGCTCGAGCAATAGGGTGAATGATCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004958.2-3537s1c1
Sequence:CCGGCCCGGATCATTCACCCTATTGCTCGAGCAATAGGGTGAATGATCCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_004958.2-6937s1c1
Sequence:CCGGGTTTGAGCATGCCGTCAATAACTCGAGTTATTGACGGCATGCTCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197118    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004958.2-8483s1c1
Sequence:CCGGGTTTAGAGCAAGGGCTCAGAACTCGAGTTCTGAGCCCTTGCTCTAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004958.2-8245s1c1
Sequence:CCGGGCAGAAATGTTTGCAAGATAGCTCGAGCTATCTTGCAAACATTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_004958.2-6293s1c1
Sequence:CCGGCAGGCCTATGGTCGAGATTTACTCGAGTAAATCTCGACCATAGGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004958.2-4662s1c1
Sequence:CCGGGCATGGAAGAATACACCTGTACTCGAGTACAGGTGTATTCTTCCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_004958.2-3425s1c1
Sequence:CCGGCCTCCTATTGTTAAGTTGTTTCTCGAGAAACAACTTAACAATAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_004958.2-2473s1c1
Sequence:CCGGCCTGGCAACAATAGGAGAATTCTCGAGAATTCTCCTATTGTTGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038674    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_004958.2-8344s1c1
Sequence:CCGGCCGCTAGTAGGGAGGTTTATTCTCGAGAATAAACCTCCCTACTAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_004958.2-7029s1c1
Sequence:CCGGGAACCAATTATACCCGTTCTTCTCGAGAAGAACGGGTATAATTGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004958.2-2162s1c1
Sequence:CCGGGCCTTGTTTGTGGCTCTGAATCTCGAGATTCAGAGCCACAAACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004958.2-5477s1c1
Sequence:CCGGGCTGTGCTACACTACAAACATCTCGAGATGTTTGTAGTGTAGCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004958.2-640s1c1
Sequence:CCGGGCAACCCTTCTTTGACAACATCTCGAGATGTTGTCAAAGAAGGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039783    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004958.2-7897s1c1
Sequence:CCGGGCTGCTGTTGAAGAATATATTCTCGAGAATATATTCTTCAACAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004958
VALIDATED
MTOR MISSION shRNA shRNA Plasmid DNA
mechanistic target of rapamycin (serine/threonine kinase)
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004958.3-682s21c1
Sequence:CCGGGCAACCCTTCTTTGACAACATCTCGAGATGTTGTCAAAGAAGGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004958.3-5519s21c1
Sequence:CCGGGCTGTGCTACACTACAAACATCTCGAGATGTTTGTAGTGTAGCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004958.3-2204s21c1
Sequence:CCGGGCCTTGTTTGTGGCTCTGAATCTCGAGATTCAGAGCCACAAACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004958.3-3579s21c1
Sequence:CCGGCCCGGATCATTCACCCTATTGCTCGAGCAATAGGGTGAATGATCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004958.2-3537s1c1
Sequence:CCGGCCCGGATCATTCACCCTATTGCTCGAGCAATAGGGTGAATGATCCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_004958.2-6937s1c1
Sequence:CCGGGTTTGAGCATGCCGTCAATAACTCGAGTTATTGACGGCATGCTCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197118    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004958.2-8483s1c1
Sequence:CCGGGTTTAGAGCAAGGGCTCAGAACTCGAGTTCTGAGCCCTTGCTCTAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004958.2-8245s1c1
Sequence:CCGGGCAGAAATGTTTGCAAGATAGCTCGAGCTATCTTGCAAACATTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_004958.2-6293s1c1
Sequence:CCGGCAGGCCTATGGTCGAGATTTACTCGAGTAAATCTCGACCATAGGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004958.2-4662s1c1
Sequence:CCGGGCATGGAAGAATACACCTGTACTCGAGTACAGGTGTATTCTTCCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_004958.2-3425s1c1
Sequence:CCGGCCTCCTATTGTTAAGTTGTTTCTCGAGAAACAACTTAACAATAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_004958.2-2473s1c1
Sequence:CCGGCCTGGCAACAATAGGAGAATTCTCGAGAATTCTCCTATTGTTGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038674    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_004958.2-8344s1c1
Sequence:CCGGCCGCTAGTAGGGAGGTTTATTCTCGAGAATAAACCTCCCTACTAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_004958.2-7029s1c1
Sequence:CCGGGAACCAATTATACCCGTTCTTCTCGAGAAGAACGGGTATAATTGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004958.2-2162s1c1
Sequence:CCGGGCCTTGTTTGTGGCTCTGAATCTCGAGATTCAGAGCCACAAACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004958.2-5477s1c1
Sequence:CCGGGCTGTGCTACACTACAAACATCTCGAGATGTTTGTAGTGTAGCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004958.2-640s1c1
Sequence:CCGGGCAACCCTTCTTTGACAACATCTCGAGATGTTGTCAAAGAAGGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039783    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004958.2-7897s1c1
Sequence:CCGGGCTGCTGTTGAAGAATATATTCTCGAGAATATATTCTTCAACAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004958
VALIDATED
MTOR MISSION shRNA Lentiviral Transduction Particles
mechanistic target of rapamycin (serine/threonine kinase)
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004958.3-682s21c1
Sequence:CCGGGCAACCCTTCTTTGACAACATCTCGAGATGTTGTCAAAGAAGGGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004958.3-5519s21c1
Sequence:CCGGGCTGTGCTACACTACAAACATCTCGAGATGTTTGTAGTGTAGCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004958.3-2204s21c1
Sequence:CCGGGCCTTGTTTGTGGCTCTGAATCTCGAGATTCAGAGCCACAAACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004958.3-3579s21c1
Sequence:CCGGCCCGGATCATTCACCCTATTGCTCGAGCAATAGGGTGAATGATCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004958.2-3537s1c1
Sequence:CCGGCCCGGATCATTCACCCTATTGCTCGAGCAATAGGGTGAATGATCCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_004958.2-6937s1c1
Sequence:CCGGGTTTGAGCATGCCGTCAATAACTCGAGTTATTGACGGCATGCTCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197118    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004958.2-8483s1c1
Sequence:CCGGGTTTAGAGCAAGGGCTCAGAACTCGAGTTCTGAGCCCTTGCTCTAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004958.2-8245s1c1
Sequence:CCGGGCAGAAATGTTTGCAAGATAGCTCGAGCTATCTTGCAAACATTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_004958.2-6293s1c1
Sequence:CCGGCAGGCCTATGGTCGAGATTTACTCGAGTAAATCTCGACCATAGGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004958.2-4662s1c1
Sequence:CCGGGCATGGAAGAATACACCTGTACTCGAGTACAGGTGTATTCTTCCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_004958.2-3425s1c1
Sequence:CCGGCCTCCTATTGTTAAGTTGTTTCTCGAGAAACAACTTAACAATAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_004958.2-2473s1c1
Sequence:CCGGCCTGGCAACAATAGGAGAATTCTCGAGAATTCTCCTATTGTTGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038674    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_004958.2-8344s1c1
Sequence:CCGGCCGCTAGTAGGGAGGTTTATTCTCGAGAATAAACCTCCCTACTAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_004958.2-7029s1c1
Sequence:CCGGGAACCAATTATACCCGTTCTTCTCGAGAAGAACGGGTATAATTGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004958.2-2162s1c1
Sequence:CCGGGCCTTGTTTGTGGCTCTGAATCTCGAGATTCAGAGCCACAAACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004958.2-5477s1c1
Sequence:CCGGGCTGTGCTACACTACAAACATCTCGAGATGTTTGTAGTGTAGCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004958.2-640s1c1
Sequence:CCGGGCAACCCTTCTTTGACAACATCTCGAGATGTTGTCAAAGAAGGGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039783    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004958.2-7897s1c1
Sequence:CCGGGCTGCTGTTGAAGAATATATTCTCGAGAATATATTCTTCAACAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020009
MTOR MISSION shRNA Bacterial Glycerol Stock
mechanistic target of rapamycin (serine/threonine kinase)
Mouse
23 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360637    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020009.2-7849s21c1
Sequence:CCGGCAGACAGTTGGACTTGTTAAACTCGAGTTTAACAAGTCCAACTGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020009.1-7075s21c1
Sequence:CCGGTGTCGATGGTCGGATACATTTCTCGAGAAATGTATCCGACCATCGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020009.1-5892s21c1
Sequence:CCGGGACACTTGGTTACAGGTTATACTCGAGTATAACCTGTAACCAAGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020009.1-4884s21c1
Sequence:CCGGTCCGAGCTGGAAGAGGTTATCCTCGAGGATAACCTCTTCCAGCTCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020009.2-3201s21c1
Sequence:CCGGCCGTCCCTACATGGATGAAATCTCGAGATTTCATCCATGTAGGGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020009.2-5814s21c1
Sequence:CCGGCAACCTCCAGGATACACTAAGCTCGAGCTTAGTGTATCCTGGAGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020009.2-7062s21c1
Sequence:CCGGTGACCGAAGAACCAACTATACCTCGAGGTATAGTTGGTTCTTCGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020009.2-1744s21c1
Sequence:CCGGATGCTGTCCCTGGTCCTTATGCTCGAGCATAAGGACCAGGGACAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020009.2-5776s21c1
Sequence:CCGGCAAGGCTTCTTCCGTTCTATCCTCGAGGATAGAACGGAAGAAGCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020009.1-8173s21c1
Sequence:CCGGCTGGATGCAGTGGCGACATTTCTCGAGAAATGTCGCCACTGCATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020009.1-7595s21c1
Sequence:CCGGTATTAACAGGGTTCGAGATAACTCGAGTTATCTCGAACCCTGTTAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020009.2-2439s21c1
Sequence:CCGGGCCTATCCTGAAGGCTTTAATCTCGAGATTAAAGCCTTCAGGATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020009.2-3244s21c1
Sequence:CCGGTGGGTCATGAACACGTCAATCCTCGAGGATTGACGTGTTCATGACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020009.1-7569s1c1
Sequence:CCGGGCCTTAAACAAGAAAGCTATTCTCGAGAATAGCTTTCTTGTTTAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020009.1-6321s1c1
Sequence:CCGGCGAGATTTAATGGAGGCACAACTCGAGTTGTGCCTCCATTAAATCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020009.1-3177s1c1
Sequence:CCGGCGTCCCTACATGGATGAAATACTCGAGTATTTCATCCATGTAGGGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020009.1-3555s1c1
Sequence:CCGGCGCATCATTCACCCAATAGTTCTCGAGAACTATTGGGTGAATGATGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020009.1-3441s1c1
Sequence:CCGGCCTCCGATTGTGAAATTGTTTCTCGAGAAACAATTTCACAATCGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020009.1-905s1c1
Sequence:CCGGGCTAGTTCGTATCAGCAGCATCTCGAGATGCTGCTGATACGAACTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020009.1-396s1c1
Sequence:CCGGTCCACCAGAATTGGCAGATTTCTCGAGAAATCTGCCAATTCTGGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020009.1-2415s1c1
Sequence:CCGGCCTATCCTGAAGGCTTTAATTCTCGAGAATTAAAGCCTTCAGGATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020009.1-5493s1c1
Sequence:CCGGGCAGTGCTACACTACAAACATCTCGAGATGTTTGTAGTGTAGCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020009.1-7520s1c1
Sequence:CCGGGCCAGAATCCATCCATTCATTCTCGAGAATGAATGGATGGATTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020009
MTOR MISSION shRNA shRNA Plasmid DNA
mechanistic target of rapamycin (serine/threonine kinase)
Mouse
23 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360637    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020009.2-7849s21c1
Sequence:CCGGCAGACAGTTGGACTTGTTAAACTCGAGTTTAACAAGTCCAACTGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020009.1-7075s21c1
Sequence:CCGGTGTCGATGGTCGGATACATTTCTCGAGAAATGTATCCGACCATCGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020009.1-5892s21c1
Sequence:CCGGGACACTTGGTTACAGGTTATACTCGAGTATAACCTGTAACCAAGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020009.1-4884s21c1
Sequence:CCGGTCCGAGCTGGAAGAGGTTATCCTCGAGGATAACCTCTTCCAGCTCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020009.2-3201s21c1
Sequence:CCGGCCGTCCCTACATGGATGAAATCTCGAGATTTCATCCATGTAGGGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020009.2-5814s21c1
Sequence:CCGGCAACCTCCAGGATACACTAAGCTCGAGCTTAGTGTATCCTGGAGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020009.2-7062s21c1
Sequence:CCGGTGACCGAAGAACCAACTATACCTCGAGGTATAGTTGGTTCTTCGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020009.2-1744s21c1
Sequence:CCGGATGCTGTCCCTGGTCCTTATGCTCGAGCATAAGGACCAGGGACAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020009.2-5776s21c1
Sequence:CCGGCAAGGCTTCTTCCGTTCTATCCTCGAGGATAGAACGGAAGAAGCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020009.1-8173s21c1
Sequence:CCGGCTGGATGCAGTGGCGACATTTCTCGAGAAATGTCGCCACTGCATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020009.1-7595s21c1
Sequence:CCGGTATTAACAGGGTTCGAGATAACTCGAGTTATCTCGAACCCTGTTAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020009.2-2439s21c1
Sequence:CCGGGCCTATCCTGAAGGCTTTAATCTCGAGATTAAAGCCTTCAGGATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020009.2-3244s21c1
Sequence:CCGGTGGGTCATGAACACGTCAATCCTCGAGGATTGACGTGTTCATGACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020009.1-7569s1c1
Sequence:CCGGGCCTTAAACAAGAAAGCTATTCTCGAGAATAGCTTTCTTGTTTAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020009.1-6321s1c1
Sequence:CCGGCGAGATTTAATGGAGGCACAACTCGAGTTGTGCCTCCATTAAATCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020009.1-3177s1c1
Sequence:CCGGCGTCCCTACATGGATGAAATACTCGAGTATTTCATCCATGTAGGGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020009.1-3555s1c1
Sequence:CCGGCGCATCATTCACCCAATAGTTCTCGAGAACTATTGGGTGAATGATGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020009.1-3441s1c1
Sequence:CCGGCCTCCGATTGTGAAATTGTTTCTCGAGAAACAATTTCACAATCGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020009.1-905s1c1
Sequence:CCGGGCTAGTTCGTATCAGCAGCATCTCGAGATGCTGCTGATACGAACTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020009.1-396s1c1
Sequence:CCGGTCCACCAGAATTGGCAGATTTCTCGAGAAATCTGCCAATTCTGGTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020009.1-2415s1c1
Sequence:CCGGCCTATCCTGAAGGCTTTAATTCTCGAGAATTAAAGCCTTCAGGATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020009.1-5493s1c1
Sequence:CCGGGCAGTGCTACACTACAAACATCTCGAGATGTTTGTAGTGTAGCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020009.1-7520s1c1
Sequence:CCGGGCCAGAATCCATCCATTCATTCTCGAGAATGAATGGATGGATTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020009
MTOR MISSION shRNA Lentiviral Transduction Particles
mechanistic target of rapamycin (serine/threonine kinase)
Mouse
23 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000360637    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020009.2-7849s21c1
Sequence:CCGGCAGACAGTTGGACTTGTTAAACTCGAGTTTAACAAGTCCAACTGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020009.1-7075s21c1
Sequence:CCGGTGTCGATGGTCGGATACATTTCTCGAGAAATGTATCCGACCATCGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020009.1-5892s21c1
Sequence:CCGGGACACTTGGTTACAGGTTATACTCGAGTATAACCTGTAACCAAGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020009.1-4884s21c1
Sequence:CCGGTCCGAGCTGGAAGAGGTTATCCTCGAGGATAACCTCTTCCAGCTCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020009.2-3201s21c1
Sequence:CCGGCCGTCCCTACATGGATGAAATCTCGAGATTTCATCCATGTAGGGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020009.2-5814s21c1
Sequence:CCGGCAACCTCCAGGATACACTAAGCTCGAGCTTAGTGTATCCTGGAGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020009.2-7062s21c1
Sequence:CCGGTGACCGAAGAACCAACTATACCTCGAGGTATAGTTGGTTCTTCGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020009.2-1744s21c1
Sequence:CCGGATGCTGTCCCTGGTCCTTATGCTCGAGCATAAGGACCAGGGACAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020009.2-5776s21c1
Sequence:CCGGCAAGGCTTCTTCCGTTCTATCCTCGAGGATAGAACGGAAGAAGCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020009.1-8173s21c1
Sequence:CCGGCTGGATGCAGTGGCGACATTTCTCGAGAAATGTCGCCACTGCATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020009.1-7595s21c1
Sequence:CCGGTATTAACAGGGTTCGAGATAACTCGAGTTATCTCGAACCCTGTTAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020009.2-2439s21c1
Sequence:CCGGGCCTATCCTGAAGGCTTTAATCTCGAGATTAAAGCCTTCAGGATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020009.2-3244s21c1
Sequence:CCGGTGGGTCATGAACACGTCAATCCTCGAGGATTGACGTGTTCATGACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020009.1-7569s1c1
Sequence:CCGGGCCTTAAACAAGAAAGCTATTCTCGAGAATAGCTTTCTTGTTTAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020009.1-6321s1c1
Sequence:CCGGCGAGATTTAATGGAGGCACAACTCGAGTTGTGCCTCCATTAAATCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020009.1-3177s1c1
Sequence:CCGGCGTCCCTACATGGATGAAATACTCGAGTATTTCATCCATGTAGGGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020009.1-3555s1c1
Sequence:CCGGCGCATCATTCACCCAATAGTTCTCGAGAACTATTGGGTGAATGATGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020009.1-3441s1c1
Sequence:CCGGCCTCCGATTGTGAAATTGTTTCTCGAGAAACAATTTCACAATCGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020009.1-905s1c1
Sequence:CCGGGCTAGTTCGTATCAGCAGCATCTCGAGATGCTGCTGATACGAACTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020009.1-396s1c1
Sequence:CCGGTCCACCAGAATTGGCAGATTTCTCGAGAAATCTGCCAATTCTGGTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020009.1-2415s1c1
Sequence:CCGGCCTATCCTGAAGGCTTTAATTCTCGAGAATTAAAGCCTTCAGGATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020009.1-5493s1c1
Sequence:CCGGGCAGTGCTACACTACAAACATCTCGAGATGTTTGTAGTGTAGCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020009.1-7520s1c1
Sequence:CCGGGCCAGAATCCATCCATTCATTCTCGAGAATGAATGGATGGATTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)