EMAIL THIS PAGE TO A FRIEND

MTPAP

mitochondrial poly(A) polymerase

77 Gene Product Result for
Synonyms: PAPD1 SPAX4
UniProtKB ID: Q9NVV4, D3DRX0, Q659E3, Q6P7E5, Q9HA74
Gene ID:
Human(55149) Summary: The protein encoded by this gene is a member of the DNA polymerase type-B-like family. This enzyme synthesizes the 3' poly(A) tail of mitochondrial transcripts and plays a role in replication-dependent histone mRNA degradation.[provided by RefSeq, Jan 2011]
Mouse(67440) mitochondrial poly(A) polymerase
Rat(307050) mitochondrial poly(A) polymerase
chicken(420478) mitochondrial poly(A) polymerase
cow(511412) mitochondrial poly(A) polymerase
Horse(100055113) mitochondrial poly(A) polymerase
dog(477963) mitochondrial poly(A) polymerase
domestic cat(101090875) mitochondrial poly(A) polymerase
sheep(101116849) mitochondrial poly(A) polymerase
domestic guinea pig(100725565) mitochondrial poly(A) polymerase
naked mole-rat(101711487) mitochondrial poly(A) polymerase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026157 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026157 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026157 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018109 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018109 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018109 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018109 Rosetta Predictions human pricing
NM_001107359 Rosetta Predictions rat pricing
NM_026157 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018109 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146902 predicted 1546
2 SASI_Hs01_00146903 predicted 1004
3 SASI_Hs01_00146904 predicted 1304
4 SASI_Hs01_00146905 predicted 1038
5 SASI_Hs01_00146906 predicted 1673
6 SASI_Hs01_00146907 predicted 795
7 SASI_Hs01_00146908 predicted 1132
8 SASI_Hs02_00351304 predicted 511
9 SASI_Hs01_00146910 predicted 870
10 SASI_Hs01_00146911 predicted 468
11 SASI_Hs01_00146909 predicted 1472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107359 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228045 predicted 1289
2 SASI_Rn02_00228046 predicted 907
3 SASI_Rn02_00228047 predicted 1058
4 SASI_Rn02_00228048 predicted 1660
5 SASI_Rn02_00228049 predicted 1315
6 SASI_Rn02_00228050 predicted 763
7 SASI_Rn02_00228051 predicted 1238
8 SASI_Rn02_00228052 predicted 1259
9 SASI_Rn02_00228053 predicted 770
10 SASI_Rn02_00228054 predicted 1139
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026157 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079344 predicted 881
2 SASI_Mm01_00079345 predicted 931
3 SASI_Mm01_00079346 predicted 682
4 SASI_Mm01_00079347 predicted 1828
5 SASI_Mm01_00079348 predicted 1008
6 SASI_Mm01_00079349 predicted 1197
7 SASI_Mm01_00079350 predicted 1437
8 SASI_Mm02_00329772 predicted 1880
9 SASI_Mm01_00079351 predicted 355
10 SASI_Mm01_00079353 predicted 734
11 SASI_Mm01_00079352 predicted 569
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026157
VALIDATED
MTPAP MISSION shRNA Bacterial Glycerol Stock
mitochondrial poly(A) polymerase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175097    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026157.1-565s1c1
Sequence:CCGGGCTCTTTGAATTACTGAGTTACTCGAGTAACTCAGTAATTCAAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026157.2-739s21c1
Sequence:CCGGGTGAACACATTTGGCAAATTACTCGAGTAATTTGCCAAATGTGTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026157.2-1300s21c1
Sequence:CCGGTTCGTCCAGGATGTGAATAAACTCGAGTTTATTCACATCCTGGACGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026157.2-1010s21c1
Sequence:CCGGGTGATCTGACTGCTAACAATACTCGAGTATTGTTAGCAGTCAGATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026157.2-2102s21c1
Sequence:CCGGTAGTACTCTCTAGTATCTATTCTCGAGAATAGATACTAGAGAGTACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026157.2-684s21c1
Sequence:CCGGGGACATTGCTGCTGCATATTTCTCGAGAAATATGCAGCAGCAATGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216003    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026157.2-1831s1c1
Sequence:CCGGCATAGGCCTTAACAGTTATATCTCGAGATATAACTGTTAAGGCCTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026157.2-1010s1c1
Sequence:CCGGGTGATCTGACTGCTAACAATACTCGAGTATTGTTAGCAGTCAGATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026157
VALIDATED
MTPAP MISSION shRNA shRNA Plasmid DNA
mitochondrial poly(A) polymerase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175097    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026157.1-565s1c1
Sequence:CCGGGCTCTTTGAATTACTGAGTTACTCGAGTAACTCAGTAATTCAAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026157.2-739s21c1
Sequence:CCGGGTGAACACATTTGGCAAATTACTCGAGTAATTTGCCAAATGTGTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026157.2-1300s21c1
Sequence:CCGGTTCGTCCAGGATGTGAATAAACTCGAGTTTATTCACATCCTGGACGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026157.2-1010s21c1
Sequence:CCGGGTGATCTGACTGCTAACAATACTCGAGTATTGTTAGCAGTCAGATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026157.2-2102s21c1
Sequence:CCGGTAGTACTCTCTAGTATCTATTCTCGAGAATAGATACTAGAGAGTACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026157.2-684s21c1
Sequence:CCGGGGACATTGCTGCTGCATATTTCTCGAGAAATATGCAGCAGCAATGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216003    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026157.2-1831s1c1
Sequence:CCGGCATAGGCCTTAACAGTTATATCTCGAGATATAACTGTTAAGGCCTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026157.2-1010s1c1
Sequence:CCGGGTGATCTGACTGCTAACAATACTCGAGTATTGTTAGCAGTCAGATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026157
VALIDATED
MTPAP MISSION shRNA Lentiviral Transduction Particles
mitochondrial poly(A) polymerase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175097    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026157.1-565s1c1
Sequence:CCGGGCTCTTTGAATTACTGAGTTACTCGAGTAACTCAGTAATTCAAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026157.2-739s21c1
Sequence:CCGGGTGAACACATTTGGCAAATTACTCGAGTAATTTGCCAAATGTGTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026157.2-1300s21c1
Sequence:CCGGTTCGTCCAGGATGTGAATAAACTCGAGTTTATTCACATCCTGGACGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026157.2-1010s21c1
Sequence:CCGGGTGATCTGACTGCTAACAATACTCGAGTATTGTTAGCAGTCAGATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026157.2-2102s21c1
Sequence:CCGGTAGTACTCTCTAGTATCTATTCTCGAGAATAGATACTAGAGAGTACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026157.2-684s21c1
Sequence:CCGGGGACATTGCTGCTGCATATTTCTCGAGAAATATGCAGCAGCAATGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216003    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026157.2-1831s1c1
Sequence:CCGGCATAGGCCTTAACAGTTATATCTCGAGATATAACTGTTAAGGCCTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026157.2-1010s1c1
Sequence:CCGGGTGATCTGACTGCTAACAATACTCGAGTATTGTTAGCAGTCAGATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018109
VALIDATED
MTPAP MISSION shRNA Bacterial Glycerol Stock
mitochondrial poly(A) polymerase
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000162272    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_018109.2-2095s1c1
Sequence:CCGGCGTGGACAACATAGCAAGATTCTCGAGAATCTTGCTATGTTGTCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162057    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018109.2-1646s1c1
Sequence:CCGGGCTCCAAACAGAAAGTCCTTTCTCGAGAAAGGACTTTCTGTTTGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160045    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_018109.2-2379s1c1
Sequence:CCGGCGAAGTTCTCTTATTCACATACTCGAGTATGTGAATAAGAGAACTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_018109.2-1180s1c1
Sequence:CCGGCCTTACAATGATGGTCATCTTCTCGAGAAGATGACCATCATTGTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160380    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_018109.2-2308s1c1
Sequence:CCGGCGTTGGCAATGAATACATTAACTCGAGTTAATGTATTCATTGCCAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_018109.2-1589s1c1
Sequence:CCGGCGACCTTCCATATCAAGTAATCTCGAGATTACTTGATATGGAAGGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018109
VALIDATED
MTPAP MISSION shRNA shRNA Plasmid DNA
mitochondrial poly(A) polymerase
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000162272    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_018109.2-2095s1c1
Sequence:CCGGCGTGGACAACATAGCAAGATTCTCGAGAATCTTGCTATGTTGTCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162057    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018109.2-1646s1c1
Sequence:CCGGGCTCCAAACAGAAAGTCCTTTCTCGAGAAAGGACTTTCTGTTTGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160045    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_018109.2-2379s1c1
Sequence:CCGGCGAAGTTCTCTTATTCACATACTCGAGTATGTGAATAAGAGAACTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_018109.2-1180s1c1
Sequence:CCGGCCTTACAATGATGGTCATCTTCTCGAGAAGATGACCATCATTGTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160380    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_018109.2-2308s1c1
Sequence:CCGGCGTTGGCAATGAATACATTAACTCGAGTTAATGTATTCATTGCCAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_018109.2-1589s1c1
Sequence:CCGGCGACCTTCCATATCAAGTAATCTCGAGATTACTTGATATGGAAGGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018109
VALIDATED
MTPAP MISSION shRNA Lentiviral Transduction Particles
mitochondrial poly(A) polymerase
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000162272    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_018109.2-2095s1c1
Sequence:CCGGCGTGGACAACATAGCAAGATTCTCGAGAATCTTGCTATGTTGTCCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162057    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018109.2-1646s1c1
Sequence:CCGGGCTCCAAACAGAAAGTCCTTTCTCGAGAAAGGACTTTCTGTTTGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160045    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_018109.2-2379s1c1
Sequence:CCGGCGAAGTTCTCTTATTCACATACTCGAGTATGTGAATAAGAGAACTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_018109.2-1180s1c1
Sequence:CCGGCCTTACAATGATGGTCATCTTCTCGAGAAGATGACCATCATTGTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160380    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_018109.2-2308s1c1
Sequence:CCGGCGTTGGCAATGAATACATTAACTCGAGTTAATGTATTCATTGCCAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_018109.2-1589s1c1
Sequence:CCGGCGACCTTCCATATCAAGTAATCTCGAGATTACTTGATATGGAAGGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)