EMAIL THIS PAGE TO A FRIEND

MTPN

myotrophin

216 Gene Product Result for
Synonyms: GCDP V-1
UniProtKB ID: P58546
Gene ID:
Human(136319) Summary: The transcript produced from this gene is bi-cistronic and can encode both myotrophin and leucine zipper protein 6. The myotrophin protein is associated with cardiac hypertrophy, where it is involved in the conversion of NFkappa B p50-p65 heterodimers to p50-p50 and p65-p65 homodimers. This protein also has a potential function in cerebellar morphogenesis, and it may be involved in the differentiation of cerebellar neurons, particularly of granule cells. A cryptic ORF at the 3' end of this transcript uses a novel internal ribosome entry site and a non-AUG translation initiation codon to produce leucine zipper protein 6, a 6.4 kDa tumor antigen that is associated with myeloproliferative disease. [provided by RefSeq, Jul 2008]
Mouse(14489) myotrophin
Rat(79215) myotrophin
Zebrafish(406240) myotrophin
cow(541099) myotrophin
dog(403487) myotrophin
chicken(395702) myotrophin
sheep(101102640) myotrophin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145808 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145808 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145808 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008098 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008098 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008098 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145808 Rosetta Predictions human pricing
NM_024374 Rosetta Predictions rat pricing
NM_008098 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145808 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056190 predicted 242
2 SASI_Hs02_00365366 predicted 355
3 SASI_Hs01_00056191 predicted 438
4 SASI_Hs01_00056192 predicted 961
5 SASI_Hs01_00056193 predicted 495
6 SASI_Hs01_00056195 predicted 259
7 SASI_Hs01_00056197 predicted 442
8 SASI_Hs01_00056198 predicted 350
9 SASI_Hs01_00056199 predicted 324
10 SASI_Hs02_00365367 predicted 317
11 SASI_Hs01_00056194 predicted 978
12 SASI_Hs01_00056196 predicted 1039
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024374 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081366 predicted 436
2 SASI_Rn01_00081365 predicted 347
3 SASI_Rn02_00263963 predicted 371
4 SASI_Rn01_00081367 predicted 283
5 SASI_Rn01_00081368 predicted 781
6 SASI_Rn01_00081369 predicted 447
7 SASI_Rn01_00081370 predicted 296
8 SASI_Rn02_00263964 predicted 340
9 SASI_Rn01_00081373 predicted 790
10 SASI_Rn01_00081374 predicted 245
11 SASI_Rn01_00081371 predicted 268
12 SASI_Rn01_00081372 predicted 251
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008098 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313125 predicted 287
2 SASI_Mm01_00073526 predicted 966
3 SASI_Mm01_00073527 predicted 971
4 SASI_Mm01_00073528 predicted 496
5 SASI_Mm01_00073529 predicted 986
6 SASI_Mm02_00313126 predicted 617
7 SASI_Mm01_00073530 predicted 412
8 SASI_Mm01_00073531 predicted 512
9 SASI_Mm01_00073532 predicted 234
10 SASI_Mm01_00073533 predicted 909
11 SASI_Mm01_00073534 predicted 515
12 SASI_Mm01_00073535 predicted 236
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145808
MTPN MISSION shRNA Bacterial Glycerol Stock
myotrophin
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145808.3-485s21c1
Sequence:CCGGAGATTGTGGGCAGCTTGAAATCTCGAGATTTCAAGCTGCCCACAATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145808.1-2353s1c1
Sequence:CCGGGCTGTCTTAATGCAGCCTATTCTCGAGAATAGGCTGCATTAAGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149912    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145808.1-668s1c1
Sequence:CCGGGCCAGCTTCTTCAGCTAAATACTCGAGTATTTAGCTGAAGAAGCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145808.1-304s1c1
Sequence:CCGGGAAGATGTCAACCGGACACTACTCGAGTAGTGTCCGGTTGACATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145808.3-520s21c1
Sequence:CCGGTGCTGAAAGGAGCAGATATTACTCGAGTAATATCTGCTCCTTTCAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147264    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145808.1-2895s1c1
Sequence:CCGGGCAGACAAATTCACAACACTTCTCGAGAAGTGTTGTGAATTTGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145808
MTPN MISSION shRNA shRNA Plasmid DNA
myotrophin
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145808.3-485s21c1
Sequence:CCGGAGATTGTGGGCAGCTTGAAATCTCGAGATTTCAAGCTGCCCACAATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145808.1-2353s1c1
Sequence:CCGGGCTGTCTTAATGCAGCCTATTCTCGAGAATAGGCTGCATTAAGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149912    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145808.1-668s1c1
Sequence:CCGGGCCAGCTTCTTCAGCTAAATACTCGAGTATTTAGCTGAAGAAGCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145808.1-304s1c1
Sequence:CCGGGAAGATGTCAACCGGACACTACTCGAGTAGTGTCCGGTTGACATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145808.3-520s21c1
Sequence:CCGGTGCTGAAAGGAGCAGATATTACTCGAGTAATATCTGCTCCTTTCAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147264    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145808.1-2895s1c1
Sequence:CCGGGCAGACAAATTCACAACACTTCTCGAGAAGTGTTGTGAATTTGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145808
MTPN MISSION shRNA Lentiviral Transduction Particles
myotrophin
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145808.3-485s21c1
Sequence:CCGGAGATTGTGGGCAGCTTGAAATCTCGAGATTTCAAGCTGCCCACAATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145808.1-2353s1c1
Sequence:CCGGGCTGTCTTAATGCAGCCTATTCTCGAGAATAGGCTGCATTAAGACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149912    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145808.1-668s1c1
Sequence:CCGGGCCAGCTTCTTCAGCTAAATACTCGAGTATTTAGCTGAAGAAGCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145808.1-304s1c1
Sequence:CCGGGAAGATGTCAACCGGACACTACTCGAGTAGTGTCCGGTTGACATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145808.3-520s21c1
Sequence:CCGGTGCTGAAAGGAGCAGATATTACTCGAGTAATATCTGCTCCTTTCAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147264    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145808.1-2895s1c1
Sequence:CCGGGCAGACAAATTCACAACACTTCTCGAGAAGTGTTGTGAATTTGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008098
VALIDATED
MTPN MISSION shRNA Bacterial Glycerol Stock
myotrophin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008098.3-306s21c1
Sequence:CCGGAGATTGTGGACAGCTTGAAATCTCGAGATTTCAAGCTGTCCACAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008098.3-364s21c1
Sequence:CCGGGCTCCAGATAAACATCATATTCTCGAGAATATGATGTTTATCTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008098.3-2061s21c1
Sequence:CCGGGCAGGGTTAAACTATTACTAACTCGAGTTAGTAATAGTTTAACCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008098.3-400s21c1
Sequence:CCGGGCTGTCTATGAGGGTCATGTTCTCGAGAACATGACCCTCATAGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008098.3-438s21c1
Sequence:CCGGTCTGTCAAAGGGTGCTGATAACTCGAGTTATCAGCACCCTTTGACAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008098.2-2062s1c1
Sequence:CCGGGCAGGGTTAAACTATTACTAACTCGAGTTAGTAATAGTTTAACCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008098.2-365s1c1
Sequence:CCGGGCTCCAGATAAACATCATATTCTCGAGAATATGATGTTTATCTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008098.2-401s1c1
Sequence:CCGGGCTGTCTATGAGGGTCATGTTCTCGAGAACATGACCCTCATAGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008098.2-398s1c1
Sequence:CCGGTCTGCTGTCTATGAGGGTCATCTCGAGATGACCCTCATAGACAGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008098.2-340s1c1
Sequence:CCGGGCTGCTGAAAGGAGCAGATATCTCGAGATATCTGCTCCTTTCAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008098
VALIDATED
MTPN MISSION shRNA shRNA Plasmid DNA
myotrophin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008098.3-306s21c1
Sequence:CCGGAGATTGTGGACAGCTTGAAATCTCGAGATTTCAAGCTGTCCACAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008098.3-364s21c1
Sequence:CCGGGCTCCAGATAAACATCATATTCTCGAGAATATGATGTTTATCTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008098.3-2061s21c1
Sequence:CCGGGCAGGGTTAAACTATTACTAACTCGAGTTAGTAATAGTTTAACCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008098.3-400s21c1
Sequence:CCGGGCTGTCTATGAGGGTCATGTTCTCGAGAACATGACCCTCATAGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008098.3-438s21c1
Sequence:CCGGTCTGTCAAAGGGTGCTGATAACTCGAGTTATCAGCACCCTTTGACAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008098.2-2062s1c1
Sequence:CCGGGCAGGGTTAAACTATTACTAACTCGAGTTAGTAATAGTTTAACCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008098.2-365s1c1
Sequence:CCGGGCTCCAGATAAACATCATATTCTCGAGAATATGATGTTTATCTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008098.2-401s1c1
Sequence:CCGGGCTGTCTATGAGGGTCATGTTCTCGAGAACATGACCCTCATAGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008098.2-398s1c1
Sequence:CCGGTCTGCTGTCTATGAGGGTCATCTCGAGATGACCCTCATAGACAGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008098.2-340s1c1
Sequence:CCGGGCTGCTGAAAGGAGCAGATATCTCGAGATATCTGCTCCTTTCAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008098
VALIDATED
MTPN MISSION shRNA Lentiviral Transduction Particles
myotrophin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008098.3-306s21c1
Sequence:CCGGAGATTGTGGACAGCTTGAAATCTCGAGATTTCAAGCTGTCCACAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008098.3-364s21c1
Sequence:CCGGGCTCCAGATAAACATCATATTCTCGAGAATATGATGTTTATCTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008098.3-2061s21c1
Sequence:CCGGGCAGGGTTAAACTATTACTAACTCGAGTTAGTAATAGTTTAACCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008098.3-400s21c1
Sequence:CCGGGCTGTCTATGAGGGTCATGTTCTCGAGAACATGACCCTCATAGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008098.3-438s21c1
Sequence:CCGGTCTGTCAAAGGGTGCTGATAACTCGAGTTATCAGCACCCTTTGACAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008098.2-2062s1c1
Sequence:CCGGGCAGGGTTAAACTATTACTAACTCGAGTTAGTAATAGTTTAACCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008098.2-365s1c1
Sequence:CCGGGCTCCAGATAAACATCATATTCTCGAGAATATGATGTTTATCTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008098.2-401s1c1
Sequence:CCGGGCTGTCTATGAGGGTCATGTTCTCGAGAACATGACCCTCATAGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008098.2-398s1c1
Sequence:CCGGTCTGCTGTCTATGAGGGTCATCTCGAGATGACCCTCATAGACAGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008098.2-340s1c1
Sequence:CCGGGCTGCTGAAAGGAGCAGATATCTCGAGATATCTGCTCCTTTCAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)