EMAIL THIS PAGE TO A FRIEND

MTR

5-methyltetrahydrofolate-homocysteine methyltransferase

152 Gene Product Result for
Synonyms: HMAG MS cblG
UniProtKB ID: Q99707, A1L4N8, A9Z1W4, B9EGF7, Q99713, Q99723
Gene ID:
Human(4548) Summary: MTR encodes the enzyme 5-methyltetrahydrofolate-homocysteine methyltransferase. This enzyme, also known as cobalamin-dependent methionine synthase, catalyzes the final step in methionine biosynthesis. Mutations in MTR have been identified as the underlying cause of methylcobalamin deficiency complementation group G. [provided by RefSeq, Jul 2008]
Mouse(238505) 5-methyltetrahydrofolate-homocysteine methyltransferase
Rat(81522) 5-methyltetrahydrofolate-homocysteine methyltransferase
Zebrafish(378847) 5-methyltetrahydrofolate-homocysteine methyltransferase
chicken(422069) 5-methyltetrahydrofolate-homocysteine methyltransferase
domestic cat(101101166) 5-methyltetrahydrofolate-homocysteine methyltransferase
cow(280869) 5-methyltetrahydrofolate-homocysteine methyltransferase
dog(479190) 5-methyltetrahydrofolate-homocysteine methyltransferase
sheep(101116797) 5-methyltetrahydrofolate-homocysteine methyltransferase
domestic guinea pig(100714133) 5-methyltetrahydrofolate-homocysteine methyltransferase
naked mole-rat(101720687) 5-methyltetrahydrofolate-homocysteine methyltransferase
Domestic Rabbit(100344428) 5-methyltetrahydrofolate-homocysteine methyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500656 Anti-MTR antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, human
ELISA, immunohistochemistry, western blot pricing
AV48473 Anti-MTR antibody produced in rabbit affinity isolated antibody human, rat, mouse, guinea pig, bovine, horse, rabbit
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000254 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000254 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000254 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081128 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081128 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081128 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000254 Rosetta Predictions human pricing
NM_030864 Rosetta Predictions rat pricing
NM_001081128 Rosetta Predictions mouse pricing
XM_138431 Rosetta Predictions mouse pricing
XM_972702 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000254 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225195 predicted 3265
2 SASI_Hs01_00225197 predicted 3442
3 SASI_Hs01_00225198 predicted 1355
4 SASI_Hs02_00302178 predicted 807
5 SASI_Hs01_00225199 predicted 1785
6 SASI_Hs01_00225200 predicted 2127
7 SASI_Hs01_00225201 predicted 3600
8 SASI_Hs02_00302179 predicted 2818
9 SASI_Hs01_00225204 predicted 3198
10 SASI_Hs02_00302180 predicted 1895
11 SASI_Hs01_00225196 predicted 2833
12 SASI_Hs01_00225202 predicted 2708
13 SASI_Hs01_00225203 predicted 3566
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030864 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264114 predicted 3087
2 SASI_Rn01_00089732 predicted 2640
3 SASI_Rn01_00089733 predicted 806
4 SASI_Rn01_00089734 predicted 2390
5 SASI_Rn01_00089735 predicted 441
6 SASI_Rn01_00089737 predicted 2780
7 SASI_Rn01_00089738 predicted 3520
8 SASI_Rn01_00089739 predicted 3298
9 SASI_Rn01_00089740 predicted 3892
10 SASI_Rn02_00264115 predicted 2549
11 SASI_Rn01_00089736 predicted 534
12 SASI_Rn01_00089741 predicted 2319
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081128 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295461 predicted 2503
2 SASI_Mm02_00295462 predicted 3859
3 SASI_Mm02_00295463 predicted 1443
4 SASI_Mm02_00295464 predicted 988
5 SASI_Mm02_00295465 predicted 2015
6 SASI_Mm02_00295466 predicted 1660
7 SASI_Mm02_00295467 predicted 2953
8 SASI_Mm02_00295468 predicted 1778
9 SASI_Mm02_00295469 predicted 219
10 SASI_Mm02_00295470 predicted 2251
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_138431 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00285097 predicted 2610
2 SASI_Mm01_00285098 predicted 3964
3 SASI_Mm01_00285099 predicted 1539
4 SASI_Mm01_00285100 predicted 1093
5 SASI_Mm01_00285101 predicted 2118
6 SASI_Mm01_00285102 predicted 1760
7 SASI_Mm01_00285103 predicted 3051
8 SASI_Mm01_00285104 predicted 1570
9 SASI_Mm01_00285105 predicted 1877
10 SASI_Mm01_00285106 predicted 2513
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_972702 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00238096 predicted 2613
2 SASI_Mm01_00238097 predicted 3957
3 SASI_Mm01_00238098 predicted 1542
4 SASI_Mm01_00238099 predicted 1087
5 SASI_Mm01_00238100 predicted 2118
6 SASI_Mm01_00238101 predicted 2136
7 SASI_Mm01_00238102 predicted 1760
8 SASI_Mm01_00238103 predicted 3054
9 SASI_Mm01_00238104 predicted 1563
10 SASI_Mm01_00238105 predicted 1883
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000254
MTR MISSION shRNA Bacterial Glycerol Stock
5-methyltetrahydrofolate-homocysteine methyltransferase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000254.1-2676s1c1
Sequence:CCGGGCTGCAATAATTTCCGAGTTACTCGAGTAACTCGGAAATTATTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000254.1-1268s1c1
Sequence:CCGGCCAGATCATATCAGGGAAATTCTCGAGAATTTCCCTGATATGATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000254.1-1416s1c1
Sequence:CCGGGCTGTAATGTTGCAGGATCAACTCGAGTTGATCCTGCAACATTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000254.1-3266s1c1
Sequence:CCGGCCCAAGATATTTAACGACAAACTCGAGTTTGTCGTTAAATATCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000254.1-1998s1c1
Sequence:CCGGCCAGAATAAGTGGAGGTCTTTCTCGAGAAAGACCTCCACTTATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000254.2-3272s21c1
Sequence:CCGGCAGTGAAGCCCACGTTTATTGCTCGAGCAATAAACGTGGGCTTCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000254.2-3536s21c1
Sequence:CCGGAGAGTATCCAAGACGACATTCCTCGAGGAATGTCGTCTTGGATACTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000254.2-2607s21c1
Sequence:CCGGGTTTCTACCTCAGGTTATAAACTCGAGTTTATAACCTGAGGTAGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000254.2-1095s21c1
Sequence:CCGGTTCAGGGACGATCGTTGATAACTCGAGTTATCAACGATCGTCCCTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000254.2-3167s21c1
Sequence:CCGGATATTAGACAGGACCATTATGCTCGAGCATAATGGTCCTGTCTAATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000254
MTR MISSION shRNA shRNA Plasmid DNA
5-methyltetrahydrofolate-homocysteine methyltransferase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000254.1-2676s1c1
Sequence:CCGGGCTGCAATAATTTCCGAGTTACTCGAGTAACTCGGAAATTATTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000254.1-1268s1c1
Sequence:CCGGCCAGATCATATCAGGGAAATTCTCGAGAATTTCCCTGATATGATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000254.1-1416s1c1
Sequence:CCGGGCTGTAATGTTGCAGGATCAACTCGAGTTGATCCTGCAACATTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000254.1-3266s1c1
Sequence:CCGGCCCAAGATATTTAACGACAAACTCGAGTTTGTCGTTAAATATCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000254.1-1998s1c1
Sequence:CCGGCCAGAATAAGTGGAGGTCTTTCTCGAGAAAGACCTCCACTTATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000254.2-3272s21c1
Sequence:CCGGCAGTGAAGCCCACGTTTATTGCTCGAGCAATAAACGTGGGCTTCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000254.2-3536s21c1
Sequence:CCGGAGAGTATCCAAGACGACATTCCTCGAGGAATGTCGTCTTGGATACTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000254.2-2607s21c1
Sequence:CCGGGTTTCTACCTCAGGTTATAAACTCGAGTTTATAACCTGAGGTAGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000254.2-1095s21c1
Sequence:CCGGTTCAGGGACGATCGTTGATAACTCGAGTTATCAACGATCGTCCCTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000254.2-3167s21c1
Sequence:CCGGATATTAGACAGGACCATTATGCTCGAGCATAATGGTCCTGTCTAATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000254
MTR MISSION shRNA Lentiviral Transduction Particles
5-methyltetrahydrofolate-homocysteine methyltransferase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000254.1-2676s1c1
Sequence:CCGGGCTGCAATAATTTCCGAGTTACTCGAGTAACTCGGAAATTATTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000254.1-1268s1c1
Sequence:CCGGCCAGATCATATCAGGGAAATTCTCGAGAATTTCCCTGATATGATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000254.1-1416s1c1
Sequence:CCGGGCTGTAATGTTGCAGGATCAACTCGAGTTGATCCTGCAACATTACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000254.1-3266s1c1
Sequence:CCGGCCCAAGATATTTAACGACAAACTCGAGTTTGTCGTTAAATATCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000254.1-1998s1c1
Sequence:CCGGCCAGAATAAGTGGAGGTCTTTCTCGAGAAAGACCTCCACTTATTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000254.2-3272s21c1
Sequence:CCGGCAGTGAAGCCCACGTTTATTGCTCGAGCAATAAACGTGGGCTTCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000254.2-3536s21c1
Sequence:CCGGAGAGTATCCAAGACGACATTCCTCGAGGAATGTCGTCTTGGATACTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000254.2-2607s21c1
Sequence:CCGGGTTTCTACCTCAGGTTATAAACTCGAGTTTATAACCTGAGGTAGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000254.2-1095s21c1
Sequence:CCGGTTCAGGGACGATCGTTGATAACTCGAGTTATCAACGATCGTCCCTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000254.2-3167s21c1
Sequence:CCGGATATTAGACAGGACCATTATGCTCGAGCATAATGGTCCTGTCTAATATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081128
MTR MISSION shRNA Bacterial Glycerol Stock
5-methyltetrahydrofolate-homocysteine methyltransferase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081128.2-2567s21c1
Sequence:CCGGTGGACCACAAAGCAGATATAACTCGAGTTATATCTGCTTTGTGGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081128.2-3914s21c1
Sequence:CCGGCTCACACTCCTTTACTCTTTCCTCGAGGAAAGAGTAAAGGAGTGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081128.2-537s21c1
Sequence:CCGGAGCTCTGGGTCCGACTAATAACTCGAGTTATTAGTCGGACCCAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081128.2-2956s21c1
Sequence:CCGGCCAGTGAAGCCCACGTTTATTCTCGAGAATAAACGTGGGCTTCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081128.2-317s21c1
Sequence:CCGGGTATAACTCAGCCTGATATTACTCGAGTAATATCAGGCTGAGTTATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081128
MTR MISSION shRNA shRNA Plasmid DNA
5-methyltetrahydrofolate-homocysteine methyltransferase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081128.2-2567s21c1
Sequence:CCGGTGGACCACAAAGCAGATATAACTCGAGTTATATCTGCTTTGTGGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081128.2-3914s21c1
Sequence:CCGGCTCACACTCCTTTACTCTTTCCTCGAGGAAAGAGTAAAGGAGTGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081128.2-537s21c1
Sequence:CCGGAGCTCTGGGTCCGACTAATAACTCGAGTTATTAGTCGGACCCAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081128.2-2956s21c1
Sequence:CCGGCCAGTGAAGCCCACGTTTATTCTCGAGAATAAACGTGGGCTTCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081128.2-317s21c1
Sequence:CCGGGTATAACTCAGCCTGATATTACTCGAGTAATATCAGGCTGAGTTATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081128
MTR MISSION shRNA Lentiviral Transduction Particles
5-methyltetrahydrofolate-homocysteine methyltransferase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081128.2-2567s21c1
Sequence:CCGGTGGACCACAAAGCAGATATAACTCGAGTTATATCTGCTTTGTGGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081128.2-3914s21c1
Sequence:CCGGCTCACACTCCTTTACTCTTTCCTCGAGGAAAGAGTAAAGGAGTGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081128.2-537s21c1
Sequence:CCGGAGCTCTGGGTCCGACTAATAACTCGAGTTATTAGTCGGACCCAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081128.2-2956s21c1
Sequence:CCGGCCAGTGAAGCCCACGTTTATTCTCGAGAATAAACGTGGGCTTCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081128.2-317s21c1
Sequence:CCGGGTATAACTCAGCCTGATATTACTCGAGTAATATCAGGCTGAGTTATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)