EMAIL THIS PAGE TO A FRIEND

MTRF1

mitochondrial translational release factor 1

69 Gene Product Result for
Synonyms: MRF1 MTTRF1 RF1
UniProtKB ID: O75570, Q5T6Y5, Q8IUQ6
Gene ID:
Human(9617) Summary: The protein encoded by this gene was determined by in silico methods to be a mitochondrial protein with similarity to the peptide chain release factors (RFs) discovered in bacteria and yeast. The peptide chain release factors direct the termination of translation in response to the peptide chain termination codons. Initially thought to have a role in the termination of mitochondria protein synthesis, a recent publication found no mitochondrial translation release functionality. Multiple alternatively spliced transcript variants have been suggested by mRNA and EST data; however, their full-length natures are not clear. [provided by RefSeq, Jul 2008]
Mouse(211253) mitochondrial translational release factor 1
Rat(686234) mitochondrial translational release factor 1
chicken(418830) mitochondrial translational release factor 1
domestic cat(101088048) mitochondrial translational release factor 1
cow(504754) mitochondrial translational release factor 1
dog(485465) mitochondrial translational release factor 1
naked mole-rat(101699792) mitochondrial translational release factor 1
domestic guinea pig(100735589) mitochondrial translational release factor 1
sheep(101107610) mitochondrial translational release factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145960 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145960 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145960 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004294 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004294 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004294 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004294 Rosetta Predictions human pricing
XM_001073018 Rosetta Predictions rat pricing
NM_145960 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004294 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213353 predicted 1298
2 SASI_Hs01_00213354 predicted 816
3 SASI_Hs01_00213355 predicted 346
4 SASI_Hs02_00337297 predicted 1298
5 SASI_Hs01_00213356 predicted 728
6 SASI_Hs01_00213357 predicted 1297
7 SASI_Hs01_00213360 predicted 1156
8 SASI_Hs02_00337298 predicted 814
9 SASI_Hs01_00213362 predicted 1046
10 SASI_Hs02_00337299 predicted 469
11 SASI_Hs01_00213358 predicted 557
12 SASI_Hs01_00213359 predicted 762
13 SASI_Hs01_00213361 predicted 1255
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073018 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00341290 predicted 681
2 SASI_Rn02_00341291 predicted 449
3 SASI_Rn02_00341292 predicted 905
4 SASI_Rn02_00341293 predicted 916
5 SASI_Rn02_00341294 predicted 1144
6 SASI_Rn02_00341295 predicted 965
7 SASI_Rn02_00341296 predicted 891
8 SASI_Rn02_00341297 predicted 872
9 SASI_Rn02_00341298 predicted 392
10 SASI_Rn02_00341299 predicted 381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145960 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021612 predicted 1389
2 SASI_Mm01_00021613 predicted 985
3 SASI_Mm01_00021614 predicted 891
4 SASI_Mm01_00021615 predicted 822
5 SASI_Mm01_00021616 predicted 1009
6 SASI_Mm01_00021617 predicted 480
7 SASI_Mm01_00021618 predicted 1019
8 SASI_Mm02_00341436 predicted 933
9 SASI_Mm01_00021619 predicted 1130
10 SASI_Mm01_00021620 predicted 955
11 SASI_Mm01_00021621 predicted 1530
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145960
MTRF1 MISSION shRNA Bacterial Glycerol Stock
mitochondrial translational release factor 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145960.3-1628s21c1
Sequence:CCGGAGTGCCTGGATCAGCTAATTGCTCGAGCAATTAGCTGATCCAGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145960.3-985s21c1
Sequence:CCGGCAACAGTTTACCCGGGAAATACTCGAGTATTTCCCGGGTAAACTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145960.3-923s21c1
Sequence:CCGGATGATTGGAGTGACGTTATTCCTCGAGGAATAACGTCACTCCAATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145960.3-1586s21c1
Sequence:CCGGCGTATGAAGTTCGTGACATTACTCGAGTAATGTCACGAACTTCATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145960.3-486s21c1
Sequence:CCGGTGATACAAGGCCGTGGAATTTCTCGAGAAATTCCACGGCCTTGTATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145960.2-1587s1c1
Sequence:CCGGCGTATGAAGTTCGTGACATTACTCGAGTAATGTCACGAACTTCATACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145960.2-1280s1c1
Sequence:CCGGGATCTGCGAGTAGACACATTTCTCGAGAAATGTGTCTACTCGCAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145960.2-764s1c1
Sequence:CCGGGAACAAGCCATTGAAGAATTACTCGAGTAATTCTTCAATGGCTTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145960
MTRF1 MISSION shRNA shRNA Plasmid DNA
mitochondrial translational release factor 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145960.3-1628s21c1
Sequence:CCGGAGTGCCTGGATCAGCTAATTGCTCGAGCAATTAGCTGATCCAGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145960.3-985s21c1
Sequence:CCGGCAACAGTTTACCCGGGAAATACTCGAGTATTTCCCGGGTAAACTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145960.3-923s21c1
Sequence:CCGGATGATTGGAGTGACGTTATTCCTCGAGGAATAACGTCACTCCAATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145960.3-1586s21c1
Sequence:CCGGCGTATGAAGTTCGTGACATTACTCGAGTAATGTCACGAACTTCATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145960.3-486s21c1
Sequence:CCGGTGATACAAGGCCGTGGAATTTCTCGAGAAATTCCACGGCCTTGTATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145960.2-1587s1c1
Sequence:CCGGCGTATGAAGTTCGTGACATTACTCGAGTAATGTCACGAACTTCATACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145960.2-1280s1c1
Sequence:CCGGGATCTGCGAGTAGACACATTTCTCGAGAAATGTGTCTACTCGCAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145960.2-764s1c1
Sequence:CCGGGAACAAGCCATTGAAGAATTACTCGAGTAATTCTTCAATGGCTTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145960
MTRF1 MISSION shRNA Lentiviral Transduction Particles
mitochondrial translational release factor 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145960.3-1628s21c1
Sequence:CCGGAGTGCCTGGATCAGCTAATTGCTCGAGCAATTAGCTGATCCAGGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145960.3-985s21c1
Sequence:CCGGCAACAGTTTACCCGGGAAATACTCGAGTATTTCCCGGGTAAACTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145960.3-923s21c1
Sequence:CCGGATGATTGGAGTGACGTTATTCCTCGAGGAATAACGTCACTCCAATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145960.3-1586s21c1
Sequence:CCGGCGTATGAAGTTCGTGACATTACTCGAGTAATGTCACGAACTTCATACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145960.3-486s21c1
Sequence:CCGGTGATACAAGGCCGTGGAATTTCTCGAGAAATTCCACGGCCTTGTATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145960.2-1587s1c1
Sequence:CCGGCGTATGAAGTTCGTGACATTACTCGAGTAATGTCACGAACTTCATACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145960.2-1280s1c1
Sequence:CCGGGATCTGCGAGTAGACACATTTCTCGAGAAATGTGTCTACTCGCAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145960.2-764s1c1
Sequence:CCGGGAACAAGCCATTGAAGAATTACTCGAGTAATTCTTCAATGGCTTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004294
VALIDATED
MTRF1 MISSION shRNA Bacterial Glycerol Stock
mitochondrial translational release factor 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_004294.2-701s21c1
Sequence:CCGGCCAACAATTTACCCGAGAAATCTCGAGATTTCTCGGGTAAATTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004294.2-996s21c1
Sequence:CCGGGATTTGCGAATAGATACATTTCTCGAGAAATGTATCTATTCGCAAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004294.2-1469s21c1
Sequence:CCGGTAAATGAAATGGACCTATATCCTCGAGGATATAGGTCCATTTCATTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004294.2-735s21c1
Sequence:CCGGCAGAATTATTCGTGCTATAAACTCGAGTTTATAGCACGAATAATTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004294.2-826s21c1
Sequence:CCGGTTTCCGGTGACGGTGTCTATACTCGAGTATAGACACCGTCACCGGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_004294.2-1348s1c1
Sequence:CCGGGCCTGGATCAGCTAATTCAGACTCGAGTCTGAATTAGCTGATCCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_004294.2-1161s1c1
Sequence:CCGGGCTAGACTCTACCAGCAGATTCTCGAGAATCTGCTGGTAGAGTCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_004294.2-922s1c1
Sequence:CCGGGCATTCACACAGGAACGATGTCTCGAGACATCGTTCCTGTGTGAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004294.2-786s1c1
Sequence:CCGGCCAGCAGATTATGGTGGACTACTCGAGTAGTCCACCATAATCTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150642    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004294.2-1711s1c1
Sequence:CCGGGACAAGTCACTTGTTCTCTTTCTCGAGAAAGAGAACAAGTGACTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004294.2-1106s1c1
Sequence:CCGGCCAACAAGAAAGATCACAGATCTCGAGATCTGTGATCTTTCTTGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153013    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004294.2-1584s1c1
Sequence:CCGGGAAGTCACATTTCCTGACCTACTCGAGTAGGTCAGGAAATGTGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004294
VALIDATED
MTRF1 MISSION shRNA shRNA Plasmid DNA
mitochondrial translational release factor 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_004294.2-701s21c1
Sequence:CCGGCCAACAATTTACCCGAGAAATCTCGAGATTTCTCGGGTAAATTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004294.2-996s21c1
Sequence:CCGGGATTTGCGAATAGATACATTTCTCGAGAAATGTATCTATTCGCAAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004294.2-1469s21c1
Sequence:CCGGTAAATGAAATGGACCTATATCCTCGAGGATATAGGTCCATTTCATTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004294.2-735s21c1
Sequence:CCGGCAGAATTATTCGTGCTATAAACTCGAGTTTATAGCACGAATAATTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004294.2-826s21c1
Sequence:CCGGTTTCCGGTGACGGTGTCTATACTCGAGTATAGACACCGTCACCGGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_004294.2-1348s1c1
Sequence:CCGGGCCTGGATCAGCTAATTCAGACTCGAGTCTGAATTAGCTGATCCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_004294.2-1161s1c1
Sequence:CCGGGCTAGACTCTACCAGCAGATTCTCGAGAATCTGCTGGTAGAGTCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_004294.2-922s1c1
Sequence:CCGGGCATTCACACAGGAACGATGTCTCGAGACATCGTTCCTGTGTGAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004294.2-786s1c1
Sequence:CCGGCCAGCAGATTATGGTGGACTACTCGAGTAGTCCACCATAATCTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150642    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004294.2-1711s1c1
Sequence:CCGGGACAAGTCACTTGTTCTCTTTCTCGAGAAAGAGAACAAGTGACTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004294.2-1106s1c1
Sequence:CCGGCCAACAAGAAAGATCACAGATCTCGAGATCTGTGATCTTTCTTGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153013    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004294.2-1584s1c1
Sequence:CCGGGAAGTCACATTTCCTGACCTACTCGAGTAGGTCAGGAAATGTGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004294
VALIDATED
MTRF1 MISSION shRNA Lentiviral Transduction Particles
mitochondrial translational release factor 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_004294.2-701s21c1
Sequence:CCGGCCAACAATTTACCCGAGAAATCTCGAGATTTCTCGGGTAAATTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004294.2-996s21c1
Sequence:CCGGGATTTGCGAATAGATACATTTCTCGAGAAATGTATCTATTCGCAAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004294.2-1469s21c1
Sequence:CCGGTAAATGAAATGGACCTATATCCTCGAGGATATAGGTCCATTTCATTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004294.2-735s21c1
Sequence:CCGGCAGAATTATTCGTGCTATAAACTCGAGTTTATAGCACGAATAATTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004294.2-826s21c1
Sequence:CCGGTTTCCGGTGACGGTGTCTATACTCGAGTATAGACACCGTCACCGGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_004294.2-1348s1c1
Sequence:CCGGGCCTGGATCAGCTAATTCAGACTCGAGTCTGAATTAGCTGATCCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_004294.2-1161s1c1
Sequence:CCGGGCTAGACTCTACCAGCAGATTCTCGAGAATCTGCTGGTAGAGTCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_004294.2-922s1c1
Sequence:CCGGGCATTCACACAGGAACGATGTCTCGAGACATCGTTCCTGTGTGAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004294.2-786s1c1
Sequence:CCGGCCAGCAGATTATGGTGGACTACTCGAGTAGTCCACCATAATCTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150642    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004294.2-1711s1c1
Sequence:CCGGGACAAGTCACTTGTTCTCTTTCTCGAGAAAGAGAACAAGTGACTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004294.2-1106s1c1
Sequence:CCGGCCAACAAGAAAGATCACAGATCTCGAGATCTGTGATCTTTCTTGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153013    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004294.2-1584s1c1
Sequence:CCGGGAAGTCACATTTCCTGACCTACTCGAGTAGGTCAGGAAATGTGACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)