EMAIL THIS PAGE TO A FRIEND

MTSS1

metastasis suppressor 1

212 Gene Product Result for
Synonyms: MIM MIMA MIMB
UniProtKB ID: O43312, Q8TCA2, Q96RX2
Gene ID:
Mouse(211401) metastasis suppressor 1
Rat(362918) metastasis suppressor 1
chicken(420336) metastasis suppressor 1
domestic cat(101086117) metastasis suppressor 1
cow(523498) metastasis suppressor 1
Horse(100067482) metastasis suppressor 1
dog(482037) metastasis suppressor 1
sheep(101105577) metastasis suppressor 1
domestic guinea pig(100733494) metastasis suppressor 1
Domestic Rabbit(100355361) metastasis suppressor 1
naked mole-rat(101711092) metastasis suppressor 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014751 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014751 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014751 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144800 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144800 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144800 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014751 Rosetta Predictions human pricing
NM_001130563 Rosetta Predictions rat pricing
NM_144800 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014751 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028752 predicted 600
2 SASI_Hs01_00028753 predicted 1141
3 SASI_Hs01_00028754 predicted 1263
4 SASI_Hs01_00028755 predicted 604
5 SASI_Hs01_00028756 predicted 1723
6 SASI_Hs01_00028757 predicted 991
7 SASI_Hs01_00028758 predicted 2617
8 SASI_Hs01_00028759 predicted 2846
9 SASI_Hs01_00028760 predicted 2136
10 SASI_Hs01_00028761 predicted 1096
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130563 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255799 predicted 2062
2 SASI_Rn02_00255800 predicted 1817
3 SASI_Rn02_00255801 predicted 319
4 SASI_Rn02_00255802 predicted 992
5 SASI_Rn02_00255803 predicted 2600
6 SASI_Rn02_00255804 predicted 1402
7 SASI_Rn02_00255805 predicted 2578
8 SASI_Rn02_00255806 predicted 955
9 SASI_Rn02_00255807 predicted 2226
10 SASI_Rn02_00255808 predicted 863
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144800 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059633 predicted 2122
2 SASI_Mm02_00340146 predicted 2035
3 SASI_Mm01_00059634 predicted 1116
4 SASI_Mm01_00059636 predicted 1629
5 SASI_Mm01_00059637 predicted 537
6 SASI_Mm02_00340147 predicted 1210
7 SASI_Mm01_00059638 predicted 1216
8 SASI_Mm01_00059640 predicted 1136
9 SASI_Mm02_00340148 predicted 2638
10 SASI_Mm01_00059641 predicted 1259
11 SASI_Mm01_00059635 predicted 1214
12 SASI_Mm01_00059639 predicted 2143
13 SASI_Mm01_00059642 predicted 2558
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014751
VALIDATED
MTSS1 MISSION shRNA Bacterial Glycerol Stock
metastasis suppressor 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014751.2-1070s1c1
Sequence:CCGGCGGCCAGTGATTGAAGAAGAACTCGAGTTCTTCTTCAATCACTGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014751.2-541s1c1
Sequence:CCGGCTATCCAGTTTGGGAAGATTTCTCGAGAAATCTTCCCAAACTGGATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014751.2-826s1c1
Sequence:CCGGGCTGGATAAAGACCACGCAAACTCGAGTTTGCGTGGTCTTTATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014751.2-1419s1c1
Sequence:CCGGCCCATGACTCAGGATTCATATCTCGAGATATGAATCCTGAGTCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_014751.2-1621s1c1
Sequence:CCGGCCTTCCAGACTACGCTCATTACTCGAGTAATGAGCGTAGTCTGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014751.4-1220s21c1
Sequence:CCGGTGACCATGGACCCTCACAAACCTCGAGGTTTGTGAGGGTCCATGGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014751.4-2863s21c1
Sequence:CCGGTGATCCATTCCACTCTATAATCTCGAGATTATAGAGTGGAATGGATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014751.4-822s21c1
Sequence:CCGGTTCGAGCGCTTTAATTGATTGCTCGAGCAATCAATTAAAGCGCTCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014751.4-2897s21c1
Sequence:CCGGTTGTAGGCAACTCGGAATATACTCGAGTATATTCCGAGTTGCCTACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014751.4-3133s21c1
Sequence:CCGGGGGAACCACGAAGTAGTTAATCTCGAGATTAACTACTTCGTGGTTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014751.4-1194s21c1
Sequence:CCGGGACCATCTCGGAAGATCTAAACTCGAGTTTAGATCTTCCGAGATGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014751.4-1038s21c1
Sequence:CCGGTGTCAATGATAAGTATCTCTTCTCGAGAAGAGATACTTATCATTGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014751.4-1269s21c1
Sequence:CCGGGGACTTGAAAGGTTCTGATTACTCGAGTAATCAGAACCTTTCAAGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014751.4-953s21c1
Sequence:CCGGAGTCCTCGGATACGCTGAAACCTCGAGGTTTCAGCGTATCCGAGGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014751
VALIDATED
MTSS1 MISSION shRNA shRNA Plasmid DNA
metastasis suppressor 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014751.2-1070s1c1
Sequence:CCGGCGGCCAGTGATTGAAGAAGAACTCGAGTTCTTCTTCAATCACTGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014751.2-541s1c1
Sequence:CCGGCTATCCAGTTTGGGAAGATTTCTCGAGAAATCTTCCCAAACTGGATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014751.2-826s1c1
Sequence:CCGGGCTGGATAAAGACCACGCAAACTCGAGTTTGCGTGGTCTTTATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014751.2-1419s1c1
Sequence:CCGGCCCATGACTCAGGATTCATATCTCGAGATATGAATCCTGAGTCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_014751.2-1621s1c1
Sequence:CCGGCCTTCCAGACTACGCTCATTACTCGAGTAATGAGCGTAGTCTGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000447397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014751.4-1220s21c1
Sequence:CCGGTGACCATGGACCCTCACAAACCTCGAGGTTTGTGAGGGTCCATGGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014751.4-2863s21c1
Sequence:CCGGTGATCCATTCCACTCTATAATCTCGAGATTATAGAGTGGAATGGATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014751.4-822s21c1
Sequence:CCGGTTCGAGCGCTTTAATTGATTGCTCGAGCAATCAATTAAAGCGCTCGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014751.4-2897s21c1
Sequence:CCGGTTGTAGGCAACTCGGAATATACTCGAGTATATTCCGAGTTGCCTACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014751.4-3133s21c1
Sequence:CCGGGGGAACCACGAAGTAGTTAATCTCGAGATTAACTACTTCGTGGTTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014751.4-1194s21c1
Sequence:CCGGGACCATCTCGGAAGATCTAAACTCGAGTTTAGATCTTCCGAGATGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014751.4-1038s21c1
Sequence:CCGGTGTCAATGATAAGTATCTCTTCTCGAGAAGAGATACTTATCATTGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014751.4-1269s21c1
Sequence:CCGGGGACTTGAAAGGTTCTGATTACTCGAGTAATCAGAACCTTTCAAGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014751.4-953s21c1
Sequence:CCGGAGTCCTCGGATACGCTGAAACCTCGAGGTTTCAGCGTATCCGAGGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014751
VALIDATED
MTSS1 MISSION shRNA Lentiviral Transduction Particles
metastasis suppressor 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014751.2-1070s1c1
Sequence:CCGGCGGCCAGTGATTGAAGAAGAACTCGAGTTCTTCTTCAATCACTGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014751.2-541s1c1
Sequence:CCGGCTATCCAGTTTGGGAAGATTTCTCGAGAAATCTTCCCAAACTGGATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014751.2-826s1c1
Sequence:CCGGGCTGGATAAAGACCACGCAAACTCGAGTTTGCGTGGTCTTTATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014751.2-1419s1c1
Sequence:CCGGCCCATGACTCAGGATTCATATCTCGAGATATGAATCCTGAGTCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_014751.2-1621s1c1
Sequence:CCGGCCTTCCAGACTACGCTCATTACTCGAGTAATGAGCGTAGTCTGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014751.4-1220s21c1
Sequence:CCGGTGACCATGGACCCTCACAAACCTCGAGGTTTGTGAGGGTCCATGGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014751.4-2863s21c1
Sequence:CCGGTGATCCATTCCACTCTATAATCTCGAGATTATAGAGTGGAATGGATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014751.4-822s21c1
Sequence:CCGGTTCGAGCGCTTTAATTGATTGCTCGAGCAATCAATTAAAGCGCTCGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014751.4-2897s21c1
Sequence:CCGGTTGTAGGCAACTCGGAATATACTCGAGTATATTCCGAGTTGCCTACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014751.4-3133s21c1
Sequence:CCGGGGGAACCACGAAGTAGTTAATCTCGAGATTAACTACTTCGTGGTTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014751.4-1194s21c1
Sequence:CCGGGACCATCTCGGAAGATCTAAACTCGAGTTTAGATCTTCCGAGATGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014751.4-1038s21c1
Sequence:CCGGTGTCAATGATAAGTATCTCTTCTCGAGAAGAGATACTTATCATTGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014751.4-1269s21c1
Sequence:CCGGGGACTTGAAAGGTTCTGATTACTCGAGTAATCAGAACCTTTCAAGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014751.4-953s21c1
Sequence:CCGGAGTCCTCGGATACGCTGAAACCTCGAGGTTTCAGCGTATCCGAGGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144800
VALIDATED
MTSS1 MISSION shRNA Bacterial Glycerol Stock
metastasis suppressor 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144800.1-2443s1c1
Sequence:CCGGGTGTCAGCAATATACCCTCTTCTCGAGAAGAGGGTATATTGCTGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144800.1-2775s1c1
Sequence:CCGGCGCGAACGAACTCTTTAATTACTCGAGTAATTAAAGAGTTCGTTCGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144800.1-1094s1c1
Sequence:CCGGCGAGGAAGAGATTTCCATGTTCTCGAGAACATGGAAATCTCTTCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144800.1-1264s1c1
Sequence:CCGGCCAGTACAACTATGTCCAGAACTCGAGTTCTGGACATAGTTGTACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144800.1-2038s1c1
Sequence:CCGGCCCAAGTTTCAGATTACGATTCTCGAGAATCGTAATCTGAAACTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193559    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144800.1-2776s1c1
Sequence:CCGGGCGAACGAACTCTTTAATTAACTCGAGTTAATTAAAGAGTTCGTTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144800.1-857s1c1
Sequence:CCGGGAAAGCTCGACAAGAGATAAACTCGAGTTTATCTCTTGTCGAGCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144800.1-762s21c1
Sequence:CCGGTTGATCGATTGCCTGATAAACCTCGAGGTTTATCAGGCAATCGATCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144800.1-1634s21c1
Sequence:CCGGCCTTCCTGACTACGCTCATTACTCGAGTAATGAGCGTAGTCAGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144800.1-1094s21c1
Sequence:CCGGCGAGGAAGAGATTTCCATGTTCTCGAGAACATGGAAATCTCTTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144800.1-974s21c1
Sequence:CCGGCCAGGATGTCAACGATAAATACTCGAGTATTTATCGTTGACATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144800.1-1432s21c1
Sequence:CCGGCCCACGACTCAGGATTCATATCTCGAGATATGAATCCTGAGTCGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144800
VALIDATED
MTSS1 MISSION shRNA shRNA Plasmid DNA
metastasis suppressor 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144800.1-2443s1c1
Sequence:CCGGGTGTCAGCAATATACCCTCTTCTCGAGAAGAGGGTATATTGCTGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144800.1-2775s1c1
Sequence:CCGGCGCGAACGAACTCTTTAATTACTCGAGTAATTAAAGAGTTCGTTCGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144800.1-1094s1c1
Sequence:CCGGCGAGGAAGAGATTTCCATGTTCTCGAGAACATGGAAATCTCTTCCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144800.1-1264s1c1
Sequence:CCGGCCAGTACAACTATGTCCAGAACTCGAGTTCTGGACATAGTTGTACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144800.1-2038s1c1
Sequence:CCGGCCCAAGTTTCAGATTACGATTCTCGAGAATCGTAATCTGAAACTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193559    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144800.1-2776s1c1
Sequence:CCGGGCGAACGAACTCTTTAATTAACTCGAGTTAATTAAAGAGTTCGTTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144800.1-857s1c1
Sequence:CCGGGAAAGCTCGACAAGAGATAAACTCGAGTTTATCTCTTGTCGAGCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144800.1-762s21c1
Sequence:CCGGTTGATCGATTGCCTGATAAACCTCGAGGTTTATCAGGCAATCGATCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144800.1-1634s21c1
Sequence:CCGGCCTTCCTGACTACGCTCATTACTCGAGTAATGAGCGTAGTCAGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144800.1-1094s21c1
Sequence:CCGGCGAGGAAGAGATTTCCATGTTCTCGAGAACATGGAAATCTCTTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144800.1-974s21c1
Sequence:CCGGCCAGGATGTCAACGATAAATACTCGAGTATTTATCGTTGACATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144800.1-1432s21c1
Sequence:CCGGCCCACGACTCAGGATTCATATCTCGAGATATGAATCCTGAGTCGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144800
VALIDATED
MTSS1 MISSION shRNA Lentiviral Transduction Particles
metastasis suppressor 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144800.1-2443s1c1
Sequence:CCGGGTGTCAGCAATATACCCTCTTCTCGAGAAGAGGGTATATTGCTGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144800.1-2775s1c1
Sequence:CCGGCGCGAACGAACTCTTTAATTACTCGAGTAATTAAAGAGTTCGTTCGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144800.1-1094s1c1
Sequence:CCGGCGAGGAAGAGATTTCCATGTTCTCGAGAACATGGAAATCTCTTCCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144800.1-1264s1c1
Sequence:CCGGCCAGTACAACTATGTCCAGAACTCGAGTTCTGGACATAGTTGTACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144800.1-2038s1c1
Sequence:CCGGCCCAAGTTTCAGATTACGATTCTCGAGAATCGTAATCTGAAACTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193559    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144800.1-2776s1c1
Sequence:CCGGGCGAACGAACTCTTTAATTAACTCGAGTTAATTAAAGAGTTCGTTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144800.1-857s1c1
Sequence:CCGGGAAAGCTCGACAAGAGATAAACTCGAGTTTATCTCTTGTCGAGCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144800.1-762s21c1
Sequence:CCGGTTGATCGATTGCCTGATAAACCTCGAGGTTTATCAGGCAATCGATCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144800.1-1634s21c1
Sequence:CCGGCCTTCCTGACTACGCTCATTACTCGAGTAATGAGCGTAGTCAGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144800.1-1094s21c1
Sequence:CCGGCGAGGAAGAGATTTCCATGTTCTCGAGAACATGGAAATCTCTTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144800.1-974s21c1
Sequence:CCGGCCAGGATGTCAACGATAAATACTCGAGTATTTATCGTTGACATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144800.1-1432s21c1
Sequence:CCGGCCCACGACTCAGGATTCATATCTCGAGATATGAATCCTGAGTCGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)