EMAIL THIS PAGE TO A FRIEND

MTSS1L

metastasis suppressor 1-like

85 Gene Product Result for
Synonyms: ABBA-1
UniProtKB ID: Q765P7, A6NJI7, Q9BUA8
Gene ID:
Mouse(244654) metastasis suppressor 1-like
Rat(307845) metastasis suppressor 1-like
naked mole-rat(101723552) metastasis suppressor 1-like
domestic guinea pig(100718220) metastasis suppressor 1-like
sheep(101114381) metastasis suppressor 1-like
Zebrafish(560413) metastasis suppressor 1-like
cow(521855) metastasis suppressor 1-like
domestic cat(101094149) metastasis suppressor 1-like
dog(610542) metastasis suppressor 1-like
chicken(415679) metastasis suppressor 1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198625 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198625 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198625 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138383 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138383 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138383 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU018031 MISSION® esiRNA esiRNA targeting mouse BC060632 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138383 Rosetta Predictions human pricing
XM_001077379 Rosetta Predictions rat pricing
XM_226503 Rosetta Predictions rat pricing
NM_198625 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138383 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095268 predicted 891
2 SASI_Hs01_00095269 predicted 2085
3 SASI_Hs01_00095270 predicted 1444
4 SASI_Hs01_00095271 predicted 2653
5 SASI_Hs01_00095272 predicted 2085
6 SASI_Hs01_00095273 predicted 474
7 SASI_Hs01_00095274 predicted 1006
8 SASI_Hs01_00095275 predicted 2642
9 SASI_Hs01_00095276 predicted 993
10 SASI_Hs01_00095277 predicted 936
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077379 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00356840 predicted 2643
2 SASI_Rn02_00356841 predicted 1310
3 SASI_Rn02_00356842 predicted 232
4 SASI_Rn02_00356843 predicted 1571
5 SASI_Rn02_00356844 predicted 773
6 SASI_Rn02_00356845 predicted 688
7 SASI_Rn02_00356846 predicted 1314
8 SASI_Rn02_00356847 predicted 2398
9 SASI_Rn02_00356848 predicted 904
10 SASI_Rn02_00356849 predicted 1202
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226503 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383615 predicted 353
2 SASI_Rn02_00383616 predicted 717
3 SASI_Rn02_00383617 predicted 1290
4 SASI_Rn02_00383618 predicted 213
5 SASI_Rn02_00383619 predicted 214
6 SASI_Rn02_00383620 predicted 614
7 SASI_Rn02_00383621 predicted 500
8 SASI_Rn02_00383622 predicted 1828
9 SASI_Rn02_00383623 predicted 361
10 SASI_Rn02_00383624 predicted 1553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198625 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199577 predicted 1201
2 SASI_Mm01_00199578 predicted 1424
3 SASI_Mm01_00199579 predicted 933
4 SASI_Mm01_00199580 predicted 2474
5 SASI_Mm01_00199581 predicted 808
6 SASI_Mm01_00199582 predicted 446
7 SASI_Mm01_00199583 predicted 723
8 SASI_Mm01_00199584 predicted 890
9 SASI_Mm01_00199585 predicted 1420
10 SASI_Mm01_00199586 predicted 572
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198625
MTSS1L MISSION shRNA Bacterial Glycerol Stock
metastasis suppressor 1-like
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198625.1-608s21c1
Sequence:CCGGGACCATGCGAAAGAGTATAAACTCGAGTTTATACTCTTTCGCATGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198625.1-951s21c1
Sequence:CCGGCCAGTGAGCAGGTGATCAAAGCTCGAGCTTTGATCACCTGCTCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250759    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198625.1-3974s21c1
Sequence:CCGGGTGGAACCCTGAGGCATATTTCTCGAGAAATATGCCTCAGGGTTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198625.1-1164s21c1
Sequence:CCGGCCGACATCACCAGCCAGAAATCTCGAGATTTCTGGCTGGTGATGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198625.1-286s21c1
Sequence:CCGGGGCCATCGTCAACGACATGAACTCGAGTTCATGTCGTTGACGATGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195810    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198625.1-3105s1c1
Sequence:CCGGCCTGTTCTTGTCTGGACACTTCTCGAGAAGTGTCCAGACAAGAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198625.1-673s1c1
Sequence:CCGGGCTACAGAAGAAAGCACGCAACTCGAGTTGCGTGCTTTCTTCTGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198625
MTSS1L MISSION shRNA shRNA Plasmid DNA
metastasis suppressor 1-like
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198625.1-608s21c1
Sequence:CCGGGACCATGCGAAAGAGTATAAACTCGAGTTTATACTCTTTCGCATGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198625.1-951s21c1
Sequence:CCGGCCAGTGAGCAGGTGATCAAAGCTCGAGCTTTGATCACCTGCTCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250759    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198625.1-3974s21c1
Sequence:CCGGGTGGAACCCTGAGGCATATTTCTCGAGAAATATGCCTCAGGGTTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198625.1-1164s21c1
Sequence:CCGGCCGACATCACCAGCCAGAAATCTCGAGATTTCTGGCTGGTGATGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198625.1-286s21c1
Sequence:CCGGGGCCATCGTCAACGACATGAACTCGAGTTCATGTCGTTGACGATGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195810    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198625.1-3105s1c1
Sequence:CCGGCCTGTTCTTGTCTGGACACTTCTCGAGAAGTGTCCAGACAAGAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198625.1-673s1c1
Sequence:CCGGGCTACAGAAGAAAGCACGCAACTCGAGTTGCGTGCTTTCTTCTGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198625
MTSS1L MISSION shRNA Lentiviral Transduction Particles
metastasis suppressor 1-like
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198625.1-608s21c1
Sequence:CCGGGACCATGCGAAAGAGTATAAACTCGAGTTTATACTCTTTCGCATGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198625.1-951s21c1
Sequence:CCGGCCAGTGAGCAGGTGATCAAAGCTCGAGCTTTGATCACCTGCTCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250759    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198625.1-3974s21c1
Sequence:CCGGGTGGAACCCTGAGGCATATTTCTCGAGAAATATGCCTCAGGGTTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198625.1-1164s21c1
Sequence:CCGGCCGACATCACCAGCCAGAAATCTCGAGATTTCTGGCTGGTGATGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198625.1-286s21c1
Sequence:CCGGGGCCATCGTCAACGACATGAACTCGAGTTCATGTCGTTGACGATGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195810    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198625.1-3105s1c1
Sequence:CCGGCCTGTTCTTGTCTGGACACTTCTCGAGAAGTGTCCAGACAAGAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198625.1-673s1c1
Sequence:CCGGGCTACAGAAGAAAGCACGCAACTCGAGTTGCGTGCTTTCTTCTGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138383
MTSS1L MISSION shRNA Bacterial Glycerol Stock
metastasis suppressor 1-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138383.1-168s1c1
Sequence:CCGGCTTCCAGAAAGTGGCTGACATCTCGAGATGTCAGCCACTTTCTGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138383.1-887s1c1
Sequence:CCGGCCCAAACATACTCACCCAGTTCTCGAGAACTGGGTGAGTATGTTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138383.1-63s1c1
Sequence:CCGGCATGAAGAGCTCCTACCCTATCTCGAGATAGGGTAGGAGCTCTTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138383.1-729s1c1
Sequence:CCGGGCAGGTAATCAAAGACCTAAACTCGAGTTTAGGTCTTTGATTACCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138383.1-727s1c1
Sequence:CCGGGAGCAGGTAATCAAAGACCTACTCGAGTAGGTCTTTGATTACCTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138383.1-1530s1c1
Sequence:CCGGGTTTGACAAGTCATCCACCATCTCGAGATGGTGGATGACTTGTCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138383.1-588s1c1
Sequence:CCGGCTTCTGCACCTTCATCACCTTCTCGAGAAGGTGATGAAGGTGCAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138383.1-1835s1c1
Sequence:CCGGGTGAGGAGTGCGTCTTCTATACTCGAGTATAGAAGACGCACTCCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138383.1-726s1c1
Sequence:CCGGCGAGCAGGTAATCAAAGACCTCTCGAGAGGTCTTTGATTACCTGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138383
MTSS1L MISSION shRNA shRNA Plasmid DNA
metastasis suppressor 1-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138383.1-168s1c1
Sequence:CCGGCTTCCAGAAAGTGGCTGACATCTCGAGATGTCAGCCACTTTCTGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138383.1-887s1c1
Sequence:CCGGCCCAAACATACTCACCCAGTTCTCGAGAACTGGGTGAGTATGTTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138383.1-63s1c1
Sequence:CCGGCATGAAGAGCTCCTACCCTATCTCGAGATAGGGTAGGAGCTCTTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138383.1-729s1c1
Sequence:CCGGGCAGGTAATCAAAGACCTAAACTCGAGTTTAGGTCTTTGATTACCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138383.1-727s1c1
Sequence:CCGGGAGCAGGTAATCAAAGACCTACTCGAGTAGGTCTTTGATTACCTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138383.1-1530s1c1
Sequence:CCGGGTTTGACAAGTCATCCACCATCTCGAGATGGTGGATGACTTGTCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138383.1-588s1c1
Sequence:CCGGCTTCTGCACCTTCATCACCTTCTCGAGAAGGTGATGAAGGTGCAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138383.1-1835s1c1
Sequence:CCGGGTGAGGAGTGCGTCTTCTATACTCGAGTATAGAAGACGCACTCCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138383.1-726s1c1
Sequence:CCGGCGAGCAGGTAATCAAAGACCTCTCGAGAGGTCTTTGATTACCTGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138383
MTSS1L MISSION shRNA Lentiviral Transduction Particles
metastasis suppressor 1-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138383.1-168s1c1
Sequence:CCGGCTTCCAGAAAGTGGCTGACATCTCGAGATGTCAGCCACTTTCTGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138383.1-887s1c1
Sequence:CCGGCCCAAACATACTCACCCAGTTCTCGAGAACTGGGTGAGTATGTTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138383.1-63s1c1
Sequence:CCGGCATGAAGAGCTCCTACCCTATCTCGAGATAGGGTAGGAGCTCTTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138383.1-729s1c1
Sequence:CCGGGCAGGTAATCAAAGACCTAAACTCGAGTTTAGGTCTTTGATTACCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138383.1-727s1c1
Sequence:CCGGGAGCAGGTAATCAAAGACCTACTCGAGTAGGTCTTTGATTACCTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138383.1-1530s1c1
Sequence:CCGGGTTTGACAAGTCATCCACCATCTCGAGATGGTGGATGACTTGTCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138383.1-588s1c1
Sequence:CCGGCTTCTGCACCTTCATCACCTTCTCGAGAAGGTGATGAAGGTGCAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138383.1-1835s1c1
Sequence:CCGGGTGAGGAGTGCGTCTTCTATACTCGAGTATAGAAGACGCACTCCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138383.1-726s1c1
Sequence:CCGGCGAGCAGGTAATCAAAGACCTCTCGAGAGGTCTTTGATTACCTGCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)