EMAIL THIS PAGE TO A FRIEND

MTTP

microsomal triglyceride transfer protein

52 Gene Product Result for
Synonyms: ABL MTP
UniProtKB ID: P55157, A8K428, Q08AM4
Gene ID:
Human(4547) Summary: MTP encodes the large subunit of the heterodimeric microsomal triglyceride transfer protein. Protein disulfide isomerase (PDI) completes the heterodimeric microsomal triglyceride transfer protein, which has been shown to play a central role in lipoprotein assembly. Mutations in MTP can cause abetalipoproteinemia. [provided by RefSeq, Jul 2008]
Mouse(17777) microsomal triglyceride transfer protein
Rat(310900) microsomal triglyceride transfer protein
chicken(422709) microsomal triglyceride transfer protein
dog(487873) microsomal triglyceride transfer protein
domestic cat(101087920) microsomal triglyceride transfer protein
cow(280868) microsomal triglyceride transfer protein
sheep(101110939) microsomal triglyceride transfer protein
domestic guinea pig(100734244) microsomal triglyceride transfer protein
naked mole-rat(101702738) microsomal triglyceride transfer protein
Domestic Rabbit(100341961) microsomal triglyceride transfer protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
MAK110 MTP Activity Assay Kit Supplied by Roar Biomedical, Inc. human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008642 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008642 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008642 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000253 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000253 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000253 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000253 Rosetta Predictions human pricing
NM_001107727 Rosetta Predictions rat pricing
NM_008642 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000253 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093624 predicted 791
2 SASI_Hs01_00093625 predicted 366
3 SASI_Hs02_00302175 predicted 1804
4 SASI_Hs01_00093627 predicted 2041
5 SASI_Hs01_00093628 predicted 2189
6 SASI_Hs01_00093630 predicted 754
7 SASI_Hs01_00093632 predicted 1048
8 SASI_Hs01_00093633 predicted 2137
9 SASI_Hs02_00302176 predicted 1908
10 SASI_Hs02_00302177 predicted 347
11 SASI_Hs01_00093626 predicted 2834
12 SASI_Hs01_00093629 predicted 723
13 SASI_Hs01_00093631 predicted 2371
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107727 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231675 predicted 1889
2 SASI_Rn02_00231676 predicted 2808
3 SASI_Rn02_00231677 predicted 1363
4 SASI_Rn02_00231678 predicted 2364
5 SASI_Rn02_00231679 predicted 1331
6 SASI_Rn02_00231680 predicted 1844
7 SASI_Rn02_00231681 predicted 1666
8 SASI_Rn02_00231682 predicted 919
9 SASI_Rn02_00231683 predicted 700
10 SASI_Rn02_00231684 predicted 2617
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008642 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120777 predicted 1994
2 SASI_Mm01_00120778 predicted 196
3 SASI_Mm01_00120779 predicted 1289
4 SASI_Mm01_00120780 predicted 1858
5 SASI_Mm01_00120781 predicted 511
6 SASI_Mm01_00120782 predicted 2534
7 SASI_Mm01_00120783 predicted 1946
8 SASI_Mm01_00120785 predicted 560
9 SASI_Mm01_00120786 predicted 2366
10 SASI_Mm02_00314365 predicted 2285
11 SASI_Mm01_00120784 predicted 228
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008642
VALIDATED
MTTP MISSION shRNA Bacterial Glycerol Stock
microsomal triglyceride transfer protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008642.1-750s1c1
Sequence:CCGGCCAACAAACCATAGCAGGAAACTCGAGTTTCCTGCTATGGTTTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008642.1-2726s21c1
Sequence:CCGGTCCACCAGAACGATATGCTATCTCGAGATAGCATATCGTTCTGGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105015    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008642.1-2726s1c1
Sequence:CCGGTCCACCAGAACGATATGCTATCTCGAGATAGCATATCGTTCTGGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008642.1-1962s1c1
Sequence:CCGGCCTGAACATCTTCCAGTACATCTCGAGATGTACTGGAAGATGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008642.1-1674s1c1
Sequence:CCGGCCCATCCTACATGGATGTGAACTCGAGTTCACATCCATGTAGGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008642.1-1252s1c1
Sequence:CCGGGCCCTCCTTAGTAAGTTCAAACTCGAGTTTGAACTTACTAAGGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008642.1-1252s21c1
Sequence:CCGGGCCCTCCTTAGTAAGTTCAAACTCGAGTTTGAACTTACTAAGGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008642.1-1962s21c1
Sequence:CCGGCCTGAACATCTTCCAGTACATCTCGAGATGTACTGGAAGATGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008642.1-750s21c1
Sequence:CCGGCCAACAAACCATAGCAGGAAACTCGAGTTTCCTGCTATGGTTTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008642
VALIDATED
MTTP MISSION shRNA shRNA Plasmid DNA
microsomal triglyceride transfer protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008642.1-750s1c1
Sequence:CCGGCCAACAAACCATAGCAGGAAACTCGAGTTTCCTGCTATGGTTTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008642.1-2726s21c1
Sequence:CCGGTCCACCAGAACGATATGCTATCTCGAGATAGCATATCGTTCTGGTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105015    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008642.1-2726s1c1
Sequence:CCGGTCCACCAGAACGATATGCTATCTCGAGATAGCATATCGTTCTGGTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008642.1-1962s1c1
Sequence:CCGGCCTGAACATCTTCCAGTACATCTCGAGATGTACTGGAAGATGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008642.1-1674s1c1
Sequence:CCGGCCCATCCTACATGGATGTGAACTCGAGTTCACATCCATGTAGGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008642.1-1252s1c1
Sequence:CCGGGCCCTCCTTAGTAAGTTCAAACTCGAGTTTGAACTTACTAAGGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008642.1-1252s21c1
Sequence:CCGGGCCCTCCTTAGTAAGTTCAAACTCGAGTTTGAACTTACTAAGGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008642.1-1962s21c1
Sequence:CCGGCCTGAACATCTTCCAGTACATCTCGAGATGTACTGGAAGATGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008642.1-750s21c1
Sequence:CCGGCCAACAAACCATAGCAGGAAACTCGAGTTTCCTGCTATGGTTTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008642
VALIDATED
MTTP MISSION shRNA Lentiviral Transduction Particles
microsomal triglyceride transfer protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008642.1-750s1c1
Sequence:CCGGCCAACAAACCATAGCAGGAAACTCGAGTTTCCTGCTATGGTTTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008642.1-2726s21c1
Sequence:CCGGTCCACCAGAACGATATGCTATCTCGAGATAGCATATCGTTCTGGTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105015    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008642.1-2726s1c1
Sequence:CCGGTCCACCAGAACGATATGCTATCTCGAGATAGCATATCGTTCTGGTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008642.1-1962s1c1
Sequence:CCGGCCTGAACATCTTCCAGTACATCTCGAGATGTACTGGAAGATGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008642.1-1674s1c1
Sequence:CCGGCCCATCCTACATGGATGTGAACTCGAGTTCACATCCATGTAGGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008642.1-1252s1c1
Sequence:CCGGGCCCTCCTTAGTAAGTTCAAACTCGAGTTTGAACTTACTAAGGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008642.1-1252s21c1
Sequence:CCGGGCCCTCCTTAGTAAGTTCAAACTCGAGTTTGAACTTACTAAGGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008642.1-1962s21c1
Sequence:CCGGCCTGAACATCTTCCAGTACATCTCGAGATGTACTGGAAGATGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008642.1-750s21c1
Sequence:CCGGCCAACAAACCATAGCAGGAAACTCGAGTTTCCTGCTATGGTTTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000253
MTTP MISSION shRNA Bacterial Glycerol Stock
microsomal triglyceride transfer protein
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000253.1-906s1c1
Sequence:CCGGGCAGCCATAATCAAAGCAGTTCTCGAGAACTGCTTTGATTATGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000253.1-2858s1c1
Sequence:CCGGGCGTTTACATATTTACCTGTACTCGAGTACAGGTAAATATGTAAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000253.1-1889s1c1
Sequence:CCGGCGCTCACAATTATGACCGTTTCTCGAGAAACGGTCATAATTGTGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000253.1-458s1c1
Sequence:CCGGCCTTCATCTAATCCATGGAAACTCGAGTTTCCATGGATTAGATGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000253.1-2668s1c1
Sequence:CCGGGCGTATTAGCAGGATGTGAATCTCGAGATTCACATCCTGCTAATACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000253
MTTP MISSION shRNA shRNA Plasmid DNA
microsomal triglyceride transfer protein
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000253.1-906s1c1
Sequence:CCGGGCAGCCATAATCAAAGCAGTTCTCGAGAACTGCTTTGATTATGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000253.1-2858s1c1
Sequence:CCGGGCGTTTACATATTTACCTGTACTCGAGTACAGGTAAATATGTAAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000253.1-1889s1c1
Sequence:CCGGCGCTCACAATTATGACCGTTTCTCGAGAAACGGTCATAATTGTGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000253.1-458s1c1
Sequence:CCGGCCTTCATCTAATCCATGGAAACTCGAGTTTCCATGGATTAGATGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000253.1-2668s1c1
Sequence:CCGGGCGTATTAGCAGGATGTGAATCTCGAGATTCACATCCTGCTAATACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000253
MTTP MISSION shRNA Lentiviral Transduction Particles
microsomal triglyceride transfer protein
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000253.1-906s1c1
Sequence:CCGGGCAGCCATAATCAAAGCAGTTCTCGAGAACTGCTTTGATTATGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000253.1-2858s1c1
Sequence:CCGGGCGTTTACATATTTACCTGTACTCGAGTACAGGTAAATATGTAAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000253.1-1889s1c1
Sequence:CCGGCGCTCACAATTATGACCGTTTCTCGAGAAACGGTCATAATTGTGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000253.1-458s1c1
Sequence:CCGGCCTTCATCTAATCCATGGAAACTCGAGTTTCCATGGATTAGATGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000253.1-2668s1c1
Sequence:CCGGGCGTATTAGCAGGATGTGAATCTCGAGATTCACATCCTGCTAATACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)