EMAIL THIS PAGE TO A FRIEND

MTUS1

microtubule associated tumor suppressor 1

177 Gene Product Result for
Synonyms: ATBP ATIP ICIS MP44 MTSG1
Gene ID:
Human(57509) Summary: This gene encodes a protein which contains a C-terminal domain able to interact with the angiotension II (AT2) receptor and a large coiled-coil region allowing dimerization. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. One of the transcript variants has been shown to encode a mitochondrial protein that acts as a tumor suppressor and partcipates in AT2 signaling pathways. Other variants may encode nuclear or transmembrane proteins but it has not been determined whether they also participate in AT2 signaling pathways. [provided by RefSeq, Jul 2008]
Mouse(102103) mitochondrial tumor suppressor 1
Rat(306487) microtubule associated tumor suppressor 1
Domestic Rabbit(100346261) microtubule associated tumor suppressor 1
naked mole-rat(101717771) microtubule associated tumor suppressor 1
domestic guinea pig(100713005) microtubule associated tumor suppressor 1
sheep(101118923) microtubule associated tumor suppressor 1
chicken(422729) microtubule associated tumor suppressor 1
dog(482896) microtubule associated tumor suppressor 1
domestic cat(101100557) microtubule associated tumor suppressor 1
cow(515016) microtubule associated tumor suppressor 1
Horse(100053906) microtubule associated tumor suppressor 1
dog(475615) microtubule associated tumor suppressor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001924 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001924 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001924 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178902 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178902 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178902 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU069491 MISSION® esiRNA esiRNA human MTUS1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001924 Rosetta Predictions human pricing
NM_001001925 Rosetta Predictions human pricing
NM_001001927 Rosetta Predictions human pricing
NM_001001931 Rosetta Predictions human pricing
NM_020749 Rosetta Predictions human pricing
NM_178093 Rosetta Predictions rat pricing
NM_001005863 Rosetta Predictions mouse pricing
NM_001005864 Rosetta Predictions mouse pricing
NM_001005865 Rosetta Predictions mouse pricing
NM_178902 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001924 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134181 predicted 4709
2 SASI_Hs01_00134182 predicted 3299
3 SASI_Hs01_00134184 predicted 3301
4 SASI_Hs01_00134185 predicted 3444
5 SASI_Hs01_00134186 predicted 4743
6 SASI_Hs01_00134187 predicted 3352
7 SASI_Hs01_00134188 predicted 3377
8 SASI_Hs01_00134189 predicted 4673
9 SASI_Hs02_00303998 predicted 4708
10 SASI_Hs02_00303999 predicted 4665
11 SASI_Hs01_00134180 predicted 3375
12 SASI_Hs01_00134183 predicted 3275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001925 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304000 predicted 4544
2 SASI_Hs01_00011708 predicted 3135
3 SASI_Hs01_00011711 predicted 3132
4 SASI_Hs01_00011714 predicted 3281
5 SASI_Hs02_00304001 predicted 4580
6 SASI_Hs01_00011715 predicted 3188
7 SASI_Hs01_00011716 predicted 3222
8 SASI_Hs02_00304002 predicted 4516
9 SASI_Hs02_00304003 predicted 4542
10 SASI_Hs02_00304004 predicted 4506
11 SASI_Hs01_00011709 predicted 3121
12 SASI_Hs01_00011710 predicted 4009
13 SASI_Hs01_00011712 predicted 4011
14 SASI_Hs01_00011713 predicted 3112
15 SASI_Hs01_00011717 predicted 3929
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001927 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217083 predicted 2203
2 SASI_Hs01_00217084 predicted 2154
3 SASI_Hs01_00217085 predicted 1489
4 SASI_Hs01_00217086 predicted 810
5 SASI_Hs01_00217087 predicted 2108
6 SASI_Hs01_00217088 predicted 1303
7 SASI_Hs01_00217089 predicted 1767
8 SASI_Hs01_00217090 predicted 2479
9 SASI_Hs01_00217091 predicted 1079
10 SASI_Hs01_00217092 predicted 704
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001931 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304014 predicted 2334
2 SASI_Hs01_00223263 predicted 919
3 SASI_Hs01_00223266 predicted 926
4 SASI_Hs01_00223269 predicted 1065
5 SASI_Hs02_00304015 predicted 2371
6 SASI_Hs01_00223270 predicted 971
7 SASI_Hs01_00223271 predicted 1011
8 SASI_Hs01_00223272 predicted 1158
9 SASI_Hs02_00304016 predicted 2301
10 SASI_Hs02_00304017 predicted 2339
11 SASI_Hs01_00223264 predicted 908
12 SASI_Hs01_00223265 predicted 1801
13 SASI_Hs01_00223267 predicted 1805
14 SASI_Hs01_00223268 predicted 904
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020749 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026702 predicted 641
2 SASI_Hs01_00026703 predicted 623
3 SASI_Hs02_00353862 predicted 1515
4 SASI_Hs01_00026704 predicted 643
5 SASI_Hs02_00353863 predicted 1511
6 SASI_Hs01_00026706 predicted 786
7 SASI_Hs01_00026707 predicted 699
8 SASI_Hs01_00026708 predicted 732
9 SASI_Hs01_00026709 predicted 881
10 SASI_Hs02_00353864 predicted 1435
11 SASI_Hs01_00026705 predicted 621
12 SASI_Hs01_00026710 predicted 834
13 SASI_Hs01_00026711 predicted 890
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178093 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269616 predicted 476
2 SASI_Rn02_00269617 predicted 981
3 SASI_Rn02_00269618 predicted 934
4 SASI_Rn02_00269619 predicted 1297
5 SASI_Rn02_00269620 predicted 1102
6 SASI_Rn02_00269621 predicted 432
7 SASI_Rn02_00269622 predicted 932
8 SASI_Rn02_00269623 predicted 919
9 SASI_Rn02_00269624 predicted 401
10 SASI_Rn02_00269625 predicted 891
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005863 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129272 predicted 3361
2 SASI_Mm01_00129273 predicted 3582
3 SASI_Mm02_00286674 predicted 3187
4 SASI_Mm01_00129275 predicted 3173
5 SASI_Mm02_00286675 predicted 3658
6 SASI_Mm02_00286676 predicted 3357
7 SASI_Mm02_00286677 predicted 3420
8 SASI_Mm01_00129277 predicted 3253
9 SASI_Mm02_00286678 predicted 3618
10 SASI_Mm02_00286679 predicted 3121
11 SASI_Mm01_00129268 predicted 2032
12 SASI_Mm01_00129269 predicted 273
13 SASI_Mm01_00129270 predicted 1269
14 SASI_Mm01_00129271 predicted 422
15 SASI_Mm01_00129274 predicted 752
16 SASI_Mm01_00129276 predicted 2744
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005864 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082055 predicted 961
2 SASI_Mm01_00082056 predicted 1193
3 SASI_Mm02_00286680 predicted 789
4 SASI_Mm02_00286681 predicted 782
5 SASI_Mm02_00286682 predicted 1260
6 SASI_Mm02_00286683 predicted 969
7 SASI_Mm01_00082059 predicted 1024
8 SASI_Mm02_00286684 predicted 855
9 SASI_Mm01_00082060 predicted 1227
10 SASI_Mm02_00286685 predicted 729
11 SASI_Mm01_00082057 predicted 999
12 SASI_Mm01_00082058 predicted 1160
13 SASI_Mm01_00082061 predicted 1221
14 SASI_Mm01_00082062 predicted 1110
15 SASI_Mm01_00082063 predicted 1025
16 SASI_Mm01_00082064 predicted 98
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005865 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081835 predicted 959
2 SASI_Mm01_00081836 predicted 1186
3 SASI_Mm01_00081837 predicted 785
4 SASI_Mm01_00081838 predicted 771
5 SASI_Mm02_00286686 predicted 1255
6 SASI_Mm01_00081839 predicted 956
7 SASI_Mm01_00081840 predicted 1024
8 SASI_Mm01_00081841 predicted 847
9 SASI_Mm01_00081842 predicted 1220
10 SASI_Mm02_00286687 predicted 722
11 SASI_Mm01_00081834 predicted 630
12 SASI_Mm01_00081843 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178902 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143734 predicted 2034
2 SASI_Mm01_00143735 predicted 2250
3 SASI_Mm01_00143736 predicted 2060
4 SASI_Mm01_00143737 predicted 2219
5 SASI_Mm01_00143738 predicted 2089
6 SASI_Mm01_00143739 predicted 2297
7 SASI_Mm01_00143740 predicted 2282
8 SASI_Mm01_00143741 predicted 2168
9 SASI_Mm01_00143742 predicted 2087
10 SASI_Mm01_00143743 predicted 876
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001924
VALIDATED
MTUS1 MISSION shRNA Bacterial Glycerol Stock
microtubule associated tumor suppressor 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000288675    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001001924.2-5066s21c1
Sequence:CCGGGCCTAACACTATCCTGTAATTCTCGAGAATTACAGGATAGTGTTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001924.2-530s21c1
Sequence:CCGGCCAGTGATAAAGATGGAAATACTCGAGTATTTCCATCTTTATCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001001924.2-1987s21c1
Sequence:CCGGCCAAACTTCAAGAATGTCAAACTCGAGTTTGACATTCTTGAAGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001001924.2-3253s21c1
Sequence:CCGGGCCTGTGGTAATACCAAGTTTCTCGAGAAACTTGGTATTACCACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001924.1-3489s1c1
Sequence:CCGGCGGGACACTTACATTGAAGAACTCGAGTTCTTCAATGTAAGTGTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001924.1-5026s1c1
Sequence:CCGGGCCTAACACTATCCTGTAATTCTCGAGAATTACAGGATAGTGTTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001924.1-1947s1c1
Sequence:CCGGCCAAACTTCAAGAATGTCAAACTCGAGTTTGACATTCTTGAAGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001924.1-490s1c1
Sequence:CCGGCCAGTGATAAAGATGGAAATACTCGAGTATTTCCATCTTTATCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001924.1-3213s1c1
Sequence:CCGGGCCTGTGGTAATACCAAGTTTCTCGAGAAACTTGGTATTACCACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001924
VALIDATED
MTUS1 MISSION shRNA shRNA Plasmid DNA
microtubule associated tumor suppressor 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000288675    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001001924.2-5066s21c1
Sequence:CCGGGCCTAACACTATCCTGTAATTCTCGAGAATTACAGGATAGTGTTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001924.2-530s21c1
Sequence:CCGGCCAGTGATAAAGATGGAAATACTCGAGTATTTCCATCTTTATCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001001924.2-1987s21c1
Sequence:CCGGCCAAACTTCAAGAATGTCAAACTCGAGTTTGACATTCTTGAAGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001001924.2-3253s21c1
Sequence:CCGGGCCTGTGGTAATACCAAGTTTCTCGAGAAACTTGGTATTACCACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001924.1-3489s1c1
Sequence:CCGGCGGGACACTTACATTGAAGAACTCGAGTTCTTCAATGTAAGTGTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001924.1-5026s1c1
Sequence:CCGGGCCTAACACTATCCTGTAATTCTCGAGAATTACAGGATAGTGTTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001924.1-1947s1c1
Sequence:CCGGCCAAACTTCAAGAATGTCAAACTCGAGTTTGACATTCTTGAAGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001924.1-490s1c1
Sequence:CCGGCCAGTGATAAAGATGGAAATACTCGAGTATTTCCATCTTTATCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001924.1-3213s1c1
Sequence:CCGGGCCTGTGGTAATACCAAGTTTCTCGAGAAACTTGGTATTACCACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001924
VALIDATED
MTUS1 MISSION shRNA Lentiviral Transduction Particles
microtubule associated tumor suppressor 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000288675    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001001924.2-5066s21c1
Sequence:CCGGGCCTAACACTATCCTGTAATTCTCGAGAATTACAGGATAGTGTTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001924.2-530s21c1
Sequence:CCGGCCAGTGATAAAGATGGAAATACTCGAGTATTTCCATCTTTATCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001001924.2-1987s21c1
Sequence:CCGGCCAAACTTCAAGAATGTCAAACTCGAGTTTGACATTCTTGAAGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001001924.2-3253s21c1
Sequence:CCGGGCCTGTGGTAATACCAAGTTTCTCGAGAAACTTGGTATTACCACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001924.1-3489s1c1
Sequence:CCGGCGGGACACTTACATTGAAGAACTCGAGTTCTTCAATGTAAGTGTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001924.1-5026s1c1
Sequence:CCGGGCCTAACACTATCCTGTAATTCTCGAGAATTACAGGATAGTGTTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001924.1-1947s1c1
Sequence:CCGGCCAAACTTCAAGAATGTCAAACTCGAGTTTGACATTCTTGAAGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001924.1-490s1c1
Sequence:CCGGCCAGTGATAAAGATGGAAATACTCGAGTATTTCCATCTTTATCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001924.1-3213s1c1
Sequence:CCGGGCCTGTGGTAATACCAAGTTTCTCGAGAAACTTGGTATTACCACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178902
VALIDATED
MTUS1 MISSION shRNA Bacterial Glycerol Stock
microtubule associated tumor suppressor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042453    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178902.3-3210s1c1
Sequence:CCGGGCCTGTATTAACCAAGTCATACTCGAGTATGACTTGGTTAATACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178902.3-304s1c1
Sequence:CCGGCGGAGCCATTTGCACAGATAACTCGAGTTATCTGTGCAAATGGCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178902.3-2327s1c1
Sequence:CCGGGCTGTGTTAGAGATCAAGAATCTCGAGATTCTTGATCTCTAACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178902.3-757s1c1
Sequence:CCGGCCCAATTAACAAGACACACAACTCGAGTTGTGTGTCTTGTTAATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178902.3-813s1c1
Sequence:CCGGCGCAAGTTACAACTCATTCTACTCGAGTAGAATGAGTTGTAACTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178902
VALIDATED
MTUS1 MISSION shRNA shRNA Plasmid DNA
microtubule associated tumor suppressor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042453    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178902.3-3210s1c1
Sequence:CCGGGCCTGTATTAACCAAGTCATACTCGAGTATGACTTGGTTAATACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178902.3-304s1c1
Sequence:CCGGCGGAGCCATTTGCACAGATAACTCGAGTTATCTGTGCAAATGGCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178902.3-2327s1c1
Sequence:CCGGGCTGTGTTAGAGATCAAGAATCTCGAGATTCTTGATCTCTAACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178902.3-757s1c1
Sequence:CCGGCCCAATTAACAAGACACACAACTCGAGTTGTGTGTCTTGTTAATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178902.3-813s1c1
Sequence:CCGGCGCAAGTTACAACTCATTCTACTCGAGTAGAATGAGTTGTAACTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178902
VALIDATED
MTUS1 MISSION shRNA Lentiviral Transduction Particles
microtubule associated tumor suppressor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042453    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178902.3-3210s1c1
Sequence:CCGGGCCTGTATTAACCAAGTCATACTCGAGTATGACTTGGTTAATACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178902.3-304s1c1
Sequence:CCGGCGGAGCCATTTGCACAGATAACTCGAGTTATCTGTGCAAATGGCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178902.3-2327s1c1
Sequence:CCGGGCTGTGTTAGAGATCAAGAATCTCGAGATTCTTGATCTCTAACACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178902.3-757s1c1
Sequence:CCGGCCCAATTAACAAGACACACAACTCGAGTTGTGTGTCTTGTTAATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178902.3-813s1c1
Sequence:CCGGCGCAAGTTACAACTCATTCTACTCGAGTAGAATGAGTTGTAACTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)