EMAIL THIS PAGE TO A FRIEND

MTUS2

microtubule associated tumor suppressor candidate 2

105 Gene Product Result for
Synonyms: CAZIP ICIS KIAA0774 TIP150
Gene ID:
Mouse(77521) microtubule associated tumor suppressor candidate 2
chicken(418923) microtubule associated tumor suppressor candidate 2
dog(486023) microtubule associated tumor suppressor candidate 2
cow(616677) microtubule associated tumor suppressor candidate 2
cow(535569) microtubule associated tumor suppressor candidate 2
sheep(101113081) microtubule associated tumor suppressor candidate 2
domestic guinea pig(100721557) microtubule associated tumor suppressor candidate 2
naked mole-rat(101709407) microtubule associated tumor suppressor candidate 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015233 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015233 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015233 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029920 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029920 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029920 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU021421 MISSION® esiRNA esiRNA human KIAA0774 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033602 Rosetta Predictions human pricing
NM_015233 Rosetta Predictions human pricing
NM_001033601 Rosetta Predictions mouse pricing
NM_029920 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033602 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035175 predicted 4104
2 SASI_Hs02_00308072 predicted 4381
3 SASI_Hs02_00308073 predicted 4041
4 SASI_Hs02_00308074 predicted 4474
5 SASI_Hs01_00035177 predicted 3762
6 SASI_Hs02_00308075 predicted 3763
7 SASI_Hs02_00308076 predicted 4435
8 SASI_Hs02_00308077 predicted 3503
9 SASI_Hs02_00308078 predicted 4469
10 SASI_Hs01_00035184 predicted 3891
11 SASI_Hs01_00035176 predicted 3839
12 SASI_Hs01_00035178 predicted 3599
13 SASI_Hs01_00035179 predicted 4075
14 SASI_Hs01_00035180 predicted 3778
15 SASI_Hs01_00035181 predicted 3443
16 SASI_Hs01_00035182 predicted 3596
17 SASI_Hs01_00035183 predicted 3520
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015233 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149790 predicted 1155
2 SASI_Hs02_00347353 predicted 1437
3 SASI_Hs02_00347354 predicted 1094
4 SASI_Hs02_00347355 predicted 1518
5 SASI_Hs01_00149792 predicted 812
6 SASI_Hs02_00347356 predicted 811
7 SASI_Hs02_00347357 predicted 1491
8 SASI_Hs02_00347358 predicted 559
9 SASI_Hs02_00347359 predicted 1523
10 SASI_Hs01_00149799 predicted 940
11 SASI_Hs01_00149791 predicted 894
12 SASI_Hs01_00149793 predicted 651
13 SASI_Hs01_00149794 predicted 1123
14 SASI_Hs01_00149795 predicted 831
15 SASI_Hs01_00149796 predicted 495
16 SASI_Hs01_00149797 predicted 650
17 SASI_Hs01_00149798 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033601 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040844 predicted 1802
2 SASI_Mm01_00040845 predicted 2512
3 SASI_Mm01_00040846 predicted 4979
4 SASI_Mm01_00040847 predicted 2970
5 SASI_Mm01_00040848 predicted 1638
6 SASI_Mm01_00040849 predicted 1128
7 SASI_Mm01_00040850 predicted 4566
8 SASI_Mm01_00040851 predicted 3021
9 SASI_Mm01_00040852 predicted 2353
10 SASI_Mm01_00040853 predicted 2560
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029920 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336175 predicted 1081
2 SASI_Mm01_00076069 predicted 1799
3 SASI_Mm01_00076071 predicted 4975
4 SASI_Mm01_00076072 predicted 1824
5 SASI_Mm01_00076073 predicted 1629
6 SASI_Mm01_00076074 predicted 1114
7 SASI_Mm01_00076075 predicted 4556
8 SASI_Mm01_00076076 predicted 3017
9 SASI_Mm01_00076077 predicted 2350
10 SASI_Mm01_00076078 predicted 2552
11 SASI_Mm01_00076070 predicted 2515
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015233
MTUS2 MISSION shRNA Bacterial Glycerol Stock
microtubule associated tumor suppressor candidate 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015233.2-336s1c1
Sequence:CCGGGCAAAGTGCGAGAAACTACAACTCGAGTTGTAGTTTCTCGCACTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015233.2-1162s1c1
Sequence:CCGGCGATTAAACTCTCGCCCACATCTCGAGATGTGGGCGAGAGTTTAATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015233.2-1110s1c1
Sequence:CCGGCGAACCAATGAAGAGCTGCTTCTCGAGAAGCAGCTCTTCATTGGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015233.2-993s1c1
Sequence:CCGGGAAGACCTCAAAGCAAGGATTCTCGAGAATCCTTGCTTTGAGGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015233.2-287s1c1
Sequence:CCGGGCTGTCAATCGAACTTGCAAACTCGAGTTTGCAAGTTCGATTGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015233.2-1590s1c1
Sequence:CCGGGCACCGATATGTGTGTATATTCTCGAGAATATACACACATATCGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015233
MTUS2 MISSION shRNA shRNA Plasmid DNA
microtubule associated tumor suppressor candidate 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015233.2-336s1c1
Sequence:CCGGGCAAAGTGCGAGAAACTACAACTCGAGTTGTAGTTTCTCGCACTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015233.2-1162s1c1
Sequence:CCGGCGATTAAACTCTCGCCCACATCTCGAGATGTGGGCGAGAGTTTAATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015233.2-1110s1c1
Sequence:CCGGCGAACCAATGAAGAGCTGCTTCTCGAGAAGCAGCTCTTCATTGGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015233.2-993s1c1
Sequence:CCGGGAAGACCTCAAAGCAAGGATTCTCGAGAATCCTTGCTTTGAGGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015233.2-287s1c1
Sequence:CCGGGCTGTCAATCGAACTTGCAAACTCGAGTTTGCAAGTTCGATTGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015233.2-1590s1c1
Sequence:CCGGGCACCGATATGTGTGTATATTCTCGAGAATATACACACATATCGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015233
MTUS2 MISSION shRNA Lentiviral Transduction Particles
microtubule associated tumor suppressor candidate 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015233.2-336s1c1
Sequence:CCGGGCAAAGTGCGAGAAACTACAACTCGAGTTGTAGTTTCTCGCACTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015233.2-1162s1c1
Sequence:CCGGCGATTAAACTCTCGCCCACATCTCGAGATGTGGGCGAGAGTTTAATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015233.2-1110s1c1
Sequence:CCGGCGAACCAATGAAGAGCTGCTTCTCGAGAAGCAGCTCTTCATTGGTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015233.2-993s1c1
Sequence:CCGGGAAGACCTCAAAGCAAGGATTCTCGAGAATCCTTGCTTTGAGGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015233.2-287s1c1
Sequence:CCGGGCTGTCAATCGAACTTGCAAACTCGAGTTTGCAAGTTCGATTGACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015233.2-1590s1c1
Sequence:CCGGGCACCGATATGTGTGTATATTCTCGAGAATATACACACATATCGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029920
MTUS2 MISSION shRNA Bacterial Glycerol Stock
microtubule associated tumor suppressor candidate 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029920.3-1101s1c1
Sequence:CCGGGAACCAACGAAGAACTACTTTCTCGAGAAAGTAGTTCTTCGTTGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029920.3-293s1c1
Sequence:CCGGGCCAACATCAGGGATGAAGTTCTCGAGAACTTCATCCCTGATGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029920.5-1111s21c1
Sequence:CCGGAGCTCGGAAATTCGAATTTAACTCGAGTTAAATTCGAATTTCCGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265093    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029920.5-5112s21c1
Sequence:CCGGTAGCTGCACAATGCATCTTAGCTCGAGCTAAGATGCATTGTGCAGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029920.5-2118s21c1
Sequence:CCGGGGTACTAGACTCACCGGTAAACTCGAGTTTACCGGTGAGTCTAGTACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029920.5-1034s21c1
Sequence:CCGGAGATACAAATGCCAATCAAATCTCGAGATTTGATTGGCATTTGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029920.5-1110s1c1
Sequence:CCGGGAGCTCGGAAATTCGAATTTACTCGAGTAAATTCGAATTTCCGAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029920
MTUS2 MISSION shRNA shRNA Plasmid DNA
microtubule associated tumor suppressor candidate 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029920.3-1101s1c1
Sequence:CCGGGAACCAACGAAGAACTACTTTCTCGAGAAAGTAGTTCTTCGTTGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029920.3-293s1c1
Sequence:CCGGGCCAACATCAGGGATGAAGTTCTCGAGAACTTCATCCCTGATGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029920.5-1111s21c1
Sequence:CCGGAGCTCGGAAATTCGAATTTAACTCGAGTTAAATTCGAATTTCCGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265093    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029920.5-5112s21c1
Sequence:CCGGTAGCTGCACAATGCATCTTAGCTCGAGCTAAGATGCATTGTGCAGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029920.5-2118s21c1
Sequence:CCGGGGTACTAGACTCACCGGTAAACTCGAGTTTACCGGTGAGTCTAGTACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029920.5-1034s21c1
Sequence:CCGGAGATACAAATGCCAATCAAATCTCGAGATTTGATTGGCATTTGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029920.5-1110s1c1
Sequence:CCGGGAGCTCGGAAATTCGAATTTACTCGAGTAAATTCGAATTTCCGAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029920
MTUS2 MISSION shRNA Lentiviral Transduction Particles
microtubule associated tumor suppressor candidate 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029920.3-1101s1c1
Sequence:CCGGGAACCAACGAAGAACTACTTTCTCGAGAAAGTAGTTCTTCGTTGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029920.3-293s1c1
Sequence:CCGGGCCAACATCAGGGATGAAGTTCTCGAGAACTTCATCCCTGATGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029920.5-1111s21c1
Sequence:CCGGAGCTCGGAAATTCGAATTTAACTCGAGTTAAATTCGAATTTCCGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265093    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029920.5-5112s21c1
Sequence:CCGGTAGCTGCACAATGCATCTTAGCTCGAGCTAAGATGCATTGTGCAGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029920.5-2118s21c1
Sequence:CCGGGGTACTAGACTCACCGGTAAACTCGAGTTTACCGGTGAGTCTAGTACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029920.5-1034s21c1
Sequence:CCGGAGATACAAATGCCAATCAAATCTCGAGATTTGATTGGCATTTGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029920.5-1110s1c1
Sequence:CCGGGAGCTCGGAAATTCGAATTTACTCGAGTAAATTCGAATTTCCGAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)