EMAIL THIS PAGE TO A FRIEND

MTX1

metaxin 1

75 Gene Product Result for
Synonyms: MTX MTXN
UniProtKB ID: Q13505, B1AVR9, B1AVS0, B2R9P4, Q9BUU3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA011543 Anti-MTX1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2101527 Anti-MTX1 antibody produced in rabbit affinity isolated antibody bovine, mouse, rat, guinea pig, rabbit, human, zebrafish, horse, pig, canine
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013604 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013604 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013604 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002455 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002455 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002455 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002455 Rosetta Predictions human pricing
NM_198883 Rosetta Predictions human pricing
NM_001100667 Rosetta Predictions rat pricing
NM_013604 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002455 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333859 predicted 779
2 SASI_Hs02_00333860 predicted 627
3 SASI_Hs01_00237460 predicted 1092
4 SASI_Hs02_00333861 predicted 627
5 SASI_Hs02_00333862 predicted 159
6 SASI_Hs02_00333863 predicted 745
7 SASI_Hs02_00333864 predicted 655
8 SASI_Hs02_00333865 predicted 658
9 SASI_Hs02_00333866 predicted 529
10 SASI_Hs02_00333867 predicted 637
11 SASI_Hs01_00237459 predicted 1232
12 SASI_Hs01_00237461 predicted 1232
13 SASI_Hs01_00237462 predicted 1279
14 SASI_Hs01_00237463 predicted 1149
15 SASI_Hs01_00237464 predicted 1370
16 SASI_Hs01_00237465 predicted 1080
17 SASI_Hs01_00237466 predicted 1258
18 SASI_Hs01_00237467 predicted 1198
19 SASI_Hs01_00237468 predicted 1345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198883 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103596 predicted 1135
2 SASI_Hs01_00103597 predicted 1000
3 SASI_Hs01_00103598 predicted 1141
4 SASI_Hs01_00103600 predicted 1046
5 SASI_Hs01_00103602 predicted 985
6 SASI_Hs01_00103603 predicted 1154
7 SASI_Hs01_00103604 predicted 1107
8 SASI_Hs01_00103605 predicted 1249
9 SASI_Hs02_00372386 predicted 1050
10 SASI_Hs02_00372387 predicted 1147
11 SASI_Hs01_00103599 predicted 1187
12 SASI_Hs01_00103601 predicted 1271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100667 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210248 predicted 568
2 SASI_Rn02_00210249 predicted 615
3 SASI_Rn02_00210250 predicted 433
4 SASI_Rn02_00210251 predicted 679
5 SASI_Rn02_00210252 predicted 536
6 SASI_Rn02_00210253 predicted 895
7 SASI_Rn02_00210254 predicted 358
8 SASI_Rn02_00210255 predicted 412
9 SASI_Rn02_00210256 predicted 978
10 SASI_Rn02_00210257 predicted 895
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013604 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068974 predicted 492
2 SASI_Mm01_00068975 predicted 267
3 SASI_Mm01_00068976 predicted 309
4 SASI_Mm01_00068977 predicted 210
5 SASI_Mm01_00068978 predicted 213
6 SASI_Mm02_00322350 predicted 277
7 SASI_Mm01_00068979 predicted 282
8 SASI_Mm01_00068981 predicted 223
9 SASI_Mm01_00068982 predicted 373
10 SASI_Mm01_00068983 predicted 245
11 SASI_Mm01_00068980 predicted 544
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013604
VALIDATED
MTX1 MISSION shRNA Bacterial Glycerol Stock
metaxin 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013604.1-233s21c1
Sequence:CCGGTTCGTAAAGAGAAGTATAATGCTCGAGCATTATACTTCTCTTTACGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013604.1-185s21c1
Sequence:CCGGCCAGTGATGGGAAAGTCATTACTCGAGTAATGACTTTCCCATCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013604.1-316s21c1
Sequence:CCGGGAGAAACTACTGCCTGTGCTACTCGAGTAGCACAGGCAGTAGTTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013604.1-87s21c1
Sequence:CCGGCGTGCTGACCTATACCAGATTCTCGAGAATCTGGTATAGGTCAGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013604.1-357s21c1
Sequence:CCGGCGCCAAGAACTATGTGGAAGTCTCGAGACTTCCACATAGTTCTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013604.1-211s1c1
Sequence:CCGGCCAGACAAGATCATCACCCATCTCGAGATGGGTGATGATCTTGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013604.1-88s1c1
Sequence:CCGGGTGCTGACCTATACCAGATTTCTCGAGAAATCTGGTATAGGTCAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013604.1-316s1c1
Sequence:CCGGGAGAAACTACTGCCTGTGCTACTCGAGTAGCACAGGCAGTAGTTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013604.1-357s1c1
Sequence:CCGGCGCCAAGAACTATGTGGAAGTCTCGAGACTTCCACATAGTTCTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013604.1-87s1c1
Sequence:CCGGCGTGCTGACCTATACCAGATTCTCGAGAATCTGGTATAGGTCAGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013604
VALIDATED
MTX1 MISSION shRNA shRNA Plasmid DNA
metaxin 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013604.1-233s21c1
Sequence:CCGGTTCGTAAAGAGAAGTATAATGCTCGAGCATTATACTTCTCTTTACGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013604.1-185s21c1
Sequence:CCGGCCAGTGATGGGAAAGTCATTACTCGAGTAATGACTTTCCCATCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013604.1-316s21c1
Sequence:CCGGGAGAAACTACTGCCTGTGCTACTCGAGTAGCACAGGCAGTAGTTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013604.1-87s21c1
Sequence:CCGGCGTGCTGACCTATACCAGATTCTCGAGAATCTGGTATAGGTCAGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013604.1-357s21c1
Sequence:CCGGCGCCAAGAACTATGTGGAAGTCTCGAGACTTCCACATAGTTCTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013604.1-211s1c1
Sequence:CCGGCCAGACAAGATCATCACCCATCTCGAGATGGGTGATGATCTTGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013604.1-88s1c1
Sequence:CCGGGTGCTGACCTATACCAGATTTCTCGAGAAATCTGGTATAGGTCAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013604.1-316s1c1
Sequence:CCGGGAGAAACTACTGCCTGTGCTACTCGAGTAGCACAGGCAGTAGTTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013604.1-357s1c1
Sequence:CCGGCGCCAAGAACTATGTGGAAGTCTCGAGACTTCCACATAGTTCTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013604.1-87s1c1
Sequence:CCGGCGTGCTGACCTATACCAGATTCTCGAGAATCTGGTATAGGTCAGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013604
VALIDATED
MTX1 MISSION shRNA Lentiviral Transduction Particles
metaxin 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013604.1-233s21c1
Sequence:CCGGTTCGTAAAGAGAAGTATAATGCTCGAGCATTATACTTCTCTTTACGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013604.1-185s21c1
Sequence:CCGGCCAGTGATGGGAAAGTCATTACTCGAGTAATGACTTTCCCATCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013604.1-316s21c1
Sequence:CCGGGAGAAACTACTGCCTGTGCTACTCGAGTAGCACAGGCAGTAGTTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013604.1-87s21c1
Sequence:CCGGCGTGCTGACCTATACCAGATTCTCGAGAATCTGGTATAGGTCAGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013604.1-357s21c1
Sequence:CCGGCGCCAAGAACTATGTGGAAGTCTCGAGACTTCCACATAGTTCTTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013604.1-211s1c1
Sequence:CCGGCCAGACAAGATCATCACCCATCTCGAGATGGGTGATGATCTTGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013604.1-88s1c1
Sequence:CCGGGTGCTGACCTATACCAGATTTCTCGAGAAATCTGGTATAGGTCAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013604.1-316s1c1
Sequence:CCGGGAGAAACTACTGCCTGTGCTACTCGAGTAGCACAGGCAGTAGTTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013604.1-357s1c1
Sequence:CCGGCGCCAAGAACTATGTGGAAGTCTCGAGACTTCCACATAGTTCTTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013604.1-87s1c1
Sequence:CCGGCGTGCTGACCTATACCAGATTCTCGAGAATCTGGTATAGGTCAGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002455
VALIDATED
MTX1 MISSION shRNA Bacterial Glycerol Stock
metaxin 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002455.3-655s21c1
Sequence:CCGGTGCTCCACTGAAGGTACACAACTCGAGTTGTGTACCTTCAGTGGAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002455.3-170s21c1
Sequence:CCGGAGTACAGGCCACGTGCAGTTTCTCGAGAAACTGCACGTGGCCTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002455.3-629s21c1
Sequence:CCGGGTGCTGACCTATGCCAGATTTCTCGAGAAATCTGGCATAGGTCAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_002455.3-782s21c1
Sequence:CCGGGAGAAGTACAATGCTGATTATCTCGAGATAATCAGCATTGTACTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002455.3-747s21c1
Sequence:CCGGCAGTTCCACACAAGATCATCACTCGAGTGATGATCTTGTGTGGAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002455.2-782s1c1
Sequence:CCGGGAGAAGTACAATGCTGATTATCTCGAGATAATCAGCATTGTACTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002455.2-512s1c1
Sequence:CCGGGAAGCACACAAGGAAGTGTTTCTCGAGAAACACTTCCTTGTGTGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002455.2-629s1c1
Sequence:CCGGGTGCTGACCTATGCCAGATTTCTCGAGAAATCTGGCATAGGTCAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_002455.2-1243s1c1
Sequence:CCGGCTGTGCCTATTGTACCCACATCTCGAGATGTGGGTACAATAGGCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_002455.2-1485s1c1
Sequence:CCGGCTGAGGAGGATGAAGAGGAATCTCGAGATTCCTCTTCATCCTCCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002455
VALIDATED
MTX1 MISSION shRNA shRNA Plasmid DNA
metaxin 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002455.3-655s21c1
Sequence:CCGGTGCTCCACTGAAGGTACACAACTCGAGTTGTGTACCTTCAGTGGAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002455.3-170s21c1
Sequence:CCGGAGTACAGGCCACGTGCAGTTTCTCGAGAAACTGCACGTGGCCTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002455.3-629s21c1
Sequence:CCGGGTGCTGACCTATGCCAGATTTCTCGAGAAATCTGGCATAGGTCAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_002455.3-782s21c1
Sequence:CCGGGAGAAGTACAATGCTGATTATCTCGAGATAATCAGCATTGTACTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002455.3-747s21c1
Sequence:CCGGCAGTTCCACACAAGATCATCACTCGAGTGATGATCTTGTGTGGAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002455.2-782s1c1
Sequence:CCGGGAGAAGTACAATGCTGATTATCTCGAGATAATCAGCATTGTACTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002455.2-512s1c1
Sequence:CCGGGAAGCACACAAGGAAGTGTTTCTCGAGAAACACTTCCTTGTGTGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002455.2-629s1c1
Sequence:CCGGGTGCTGACCTATGCCAGATTTCTCGAGAAATCTGGCATAGGTCAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_002455.2-1243s1c1
Sequence:CCGGCTGTGCCTATTGTACCCACATCTCGAGATGTGGGTACAATAGGCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_002455.2-1485s1c1
Sequence:CCGGCTGAGGAGGATGAAGAGGAATCTCGAGATTCCTCTTCATCCTCCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002455
VALIDATED
MTX1 MISSION shRNA Lentiviral Transduction Particles
metaxin 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002455.3-655s21c1
Sequence:CCGGTGCTCCACTGAAGGTACACAACTCGAGTTGTGTACCTTCAGTGGAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002455.3-170s21c1
Sequence:CCGGAGTACAGGCCACGTGCAGTTTCTCGAGAAACTGCACGTGGCCTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002455.3-629s21c1
Sequence:CCGGGTGCTGACCTATGCCAGATTTCTCGAGAAATCTGGCATAGGTCAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_002455.3-782s21c1
Sequence:CCGGGAGAAGTACAATGCTGATTATCTCGAGATAATCAGCATTGTACTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002455.3-747s21c1
Sequence:CCGGCAGTTCCACACAAGATCATCACTCGAGTGATGATCTTGTGTGGAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002455.2-782s1c1
Sequence:CCGGGAGAAGTACAATGCTGATTATCTCGAGATAATCAGCATTGTACTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002455.2-512s1c1
Sequence:CCGGGAAGCACACAAGGAAGTGTTTCTCGAGAAACACTTCCTTGTGTGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002455.2-629s1c1
Sequence:CCGGGTGCTGACCTATGCCAGATTTCTCGAGAAATCTGGCATAGGTCAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_002455.2-1243s1c1
Sequence:CCGGCTGTGCCTATTGTACCCACATCTCGAGATGTGGGTACAATAGGCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_002455.2-1485s1c1
Sequence:CCGGCTGAGGAGGATGAAGAGGAATCTCGAGATTCCTCTTCATCCTCCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)