EMAIL THIS PAGE TO A FRIEND

MTX3

metaxin 3

233 Gene Product Result for
UniProtKB ID: Q5HYI7, B4DL65, E9PB57, Q7Z380, Q8NB92
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001162945 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001162945 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001162945 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001010891 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010891 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010891 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010891 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010891 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305863 predicted 990
2 SASI_Hs02_00305864 predicted 1042
3 SASI_Hs02_00305865 predicted 967
4 SASI_Hs02_00305866 predicted 1000
5 SASI_Hs01_00109931 predicted 261
6 SASI_Hs02_00305867 predicted 1035
7 SASI_Hs01_00109934 predicted 395
8 SASI_Hs02_00305868 predicted 1034
9 SASI_Hs02_00305869 predicted 990
10 SASI_Hs02_00305870 predicted 745
11 SASI_Hs01_00109928 predicted 526
12 SASI_Hs01_00109929 predicted 303
13 SASI_Hs01_00109930 predicted 566
14 SASI_Hs01_00109932 predicted 298
15 SASI_Hs01_00109933 predicted 660
16 SASI_Hs01_00109935 predicted 800
17 SASI_Hs01_00109936 predicted 149
18 SASI_Hs01_00109937 predicted 520
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001162945
VALIDATED
MTX3 MISSION shRNA Bacterial Glycerol Stock
metaxin 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001162945.1-609s21c1
Sequence:CCGGCGGTTTCCTTGCGCCTCTTTACTCGAGTAAAGAGGCGCAAGGAAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001162945.1-490s21c1
Sequence:CCGGGAAGTGGAAGCACAGATATATCTCGAGATATATCTGTGCTTCCACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346666    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001162945.1-1301s21c1
Sequence:CCGGTAGACTTGTCTCAGTACATAACTCGAGTTATGTACTGAGACAAGTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162945.1-526s21c1
Sequence:CCGGTGCCTAAATCTCCTATCAAACCTCGAGGTTTGATAGGAGATTTAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162945.1-800s21c1
Sequence:CCGGTAAATAAGGAGTCCAACTTAACTCGAGTTAAGTTGGACTCCTTATTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001162945
VALIDATED
MTX3 MISSION shRNA shRNA Plasmid DNA
metaxin 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001162945.1-609s21c1
Sequence:CCGGCGGTTTCCTTGCGCCTCTTTACTCGAGTAAAGAGGCGCAAGGAAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001162945.1-490s21c1
Sequence:CCGGGAAGTGGAAGCACAGATATATCTCGAGATATATCTGTGCTTCCACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346666    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001162945.1-1301s21c1
Sequence:CCGGTAGACTTGTCTCAGTACATAACTCGAGTTATGTACTGAGACAAGTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162945.1-526s21c1
Sequence:CCGGTGCCTAAATCTCCTATCAAACCTCGAGGTTTGATAGGAGATTTAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162945.1-800s21c1
Sequence:CCGGTAAATAAGGAGTCCAACTTAACTCGAGTTAAGTTGGACTCCTTATTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001162945
VALIDATED
MTX3 MISSION shRNA Lentiviral Transduction Particles
metaxin 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001162945.1-609s21c1
Sequence:CCGGCGGTTTCCTTGCGCCTCTTTACTCGAGTAAAGAGGCGCAAGGAAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001162945.1-490s21c1
Sequence:CCGGGAAGTGGAAGCACAGATATATCTCGAGATATATCTGTGCTTCCACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346666    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001162945.1-1301s21c1
Sequence:CCGGTAGACTTGTCTCAGTACATAACTCGAGTTATGTACTGAGACAAGTCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162945.1-526s21c1
Sequence:CCGGTGCCTAAATCTCCTATCAAACCTCGAGGTTTGATAGGAGATTTAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162945.1-800s21c1
Sequence:CCGGTAAATAAGGAGTCCAACTTAACTCGAGTTAAGTTGGACTCCTTATTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010891
MTX3 MISSION shRNA Bacterial Glycerol Stock
metaxin 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010891.1-454s1c1
Sequence:CCGGCAGCAAATCTTATCAAGTCGTCTCGAGACGACTTGATAAGATTTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010891.1-292s1c1
Sequence:CCGGGCAGATACATTGGCTTATATTCTCGAGAATATAAGCCAATGTATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010891.1-263s1c1
Sequence:CCGGCTGATTATGAACTCTCAGCAACTCGAGTTGCTGAGAGTTCATAATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010891.1-130s1c1
Sequence:CCGGCCCTTGAAAGTCAATGTGATACTCGAGTATCACATTGACTTTCAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010891.1-472s1c1
Sequence:CCGGCGTGCAGGAACCCATATGTTACTCGAGTAACATATGGGTTCCTGCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010891
MTX3 MISSION shRNA shRNA Plasmid DNA
metaxin 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010891.1-454s1c1
Sequence:CCGGCAGCAAATCTTATCAAGTCGTCTCGAGACGACTTGATAAGATTTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010891.1-292s1c1
Sequence:CCGGGCAGATACATTGGCTTATATTCTCGAGAATATAAGCCAATGTATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010891.1-263s1c1
Sequence:CCGGCTGATTATGAACTCTCAGCAACTCGAGTTGCTGAGAGTTCATAATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010891.1-130s1c1
Sequence:CCGGCCCTTGAAAGTCAATGTGATACTCGAGTATCACATTGACTTTCAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010891.1-472s1c1
Sequence:CCGGCGTGCAGGAACCCATATGTTACTCGAGTAACATATGGGTTCCTGCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010891
MTX3 MISSION shRNA Lentiviral Transduction Particles
metaxin 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010891.1-454s1c1
Sequence:CCGGCAGCAAATCTTATCAAGTCGTCTCGAGACGACTTGATAAGATTTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010891.1-292s1c1
Sequence:CCGGGCAGATACATTGGCTTATATTCTCGAGAATATAAGCCAATGTATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010891.1-263s1c1
Sequence:CCGGCTGATTATGAACTCTCAGCAACTCGAGTTGCTGAGAGTTCATAATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010891.1-130s1c1
Sequence:CCGGCCCTTGAAAGTCAATGTGATACTCGAGTATCACATTGACTTTCAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010891.1-472s1c1
Sequence:CCGGCGTGCAGGAACCCATATGTTACTCGAGTAACATATGGGTTCCTGCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)