EMAIL THIS PAGE TO A FRIEND

MUC13

mucin 13, cell surface associated

133 Gene Product Result for
Synonyms: DRCC1 MUC-13
UniProtKB ID: Q9H3R2, Q6UWD9, Q9NXT5
Gene ID:
Human(56667) Summary: Epithelial mucins, such as MUC13, are a family of secreted and cell surface glycoproteins expressed by ductal and glandular epithelial tissues (Williams et al., 2001 [PubMed 11278439]
Mouse(17063) mucin 13, epithelial transmembrane
Rat(207126) mucin 13, cell surface associated
chicken(771569) mucin 13, cell surface associated
cow(100295610) mucin 13, cell surface associated
domestic cat(101101499) mucin 13, cell surface associated
dog(478594) mucin 13, cell surface associated
chicken(100859223) mucin 13, cell surface associated
sheep(101121144) mucin 13, cell surface associated
naked mole-rat(101722346) mucin 13, cell surface associated
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033049 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033049 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033049 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010739 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010739 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010739 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU038491 MISSION® esiRNA esiRNA human MUC13 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033049 Rosetta Predictions human pricing
NM_139041 Rosetta Predictions rat pricing
NM_010739 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033049 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162666 predicted 1594
2 SASI_Hs01_00162667 predicted 555
3 SASI_Hs01_00162669 predicted 781
4 SASI_Hs01_00162670 predicted 846
5 SASI_Hs01_00162671 predicted 412
6 SASI_Hs02_00360741 predicted 1601
7 SASI_Hs01_00162672 predicted 1325
8 SASI_Hs01_00162673 predicted 899
9 SASI_Hs01_00162674 predicted 860
10 SASI_Hs02_00360742 predicted 562
11 SASI_Hs01_00162668 predicted 245
12 SASI_Hs01_00162675 predicted 943
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139041 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094129 predicted 775
2 SASI_Rn01_00094130 predicted 878
3 SASI_Rn01_00094131 predicted 896
4 SASI_Rn02_00268419 predicted 1139
5 SASI_Rn01_00094132 predicted 1094
6 SASI_Rn01_00094133 predicted 830
7 SASI_Rn01_00094134 predicted 707
8 SASI_Rn01_00094135 predicted 797
9 SASI_Rn01_00094136 predicted 1632
10 SASI_Rn01_00094137 predicted 1245
11 SASI_Rn01_00094138 predicted 1378
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010739 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027197 predicted 1084
2 SASI_Mm01_00027198 predicted 1335
3 SASI_Mm01_00027199 predicted 1355
4 SASI_Mm01_00027200 predicted 1292
5 SASI_Mm01_00027201 predicted 485
6 SASI_Mm01_00027202 predicted 1148
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033049
MUC13 MISSION shRNA Bacterial Glycerol Stock
mucin 13, cell surface associated
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033049.2-1949s21c1
Sequence:CCGGTTGAGTTAAGTGACCTAATTCCTCGAGGAATTAGGTCACTTAACTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033049.2-1595s21c1
Sequence:CCGGACCAATGTACAAGCTATTATTCTCGAGAATAATAGCTTGTACATTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033049.1-714s1c1
Sequence:CCGGCCCAGAAGAGAAACATTCCATCTCGAGATGGAATGTTTCTCTTCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033049.1-1393s1c1
Sequence:CCGGGAAGAGAACTTGATTGACGAACTCGAGTTCGTCAATCAAGTTCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033049.1-569s1c1
Sequence:CCGGCCTGTGCAGATAATTCGTTATCTCGAGATAACGAATTATCTGCACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033049.1-1262s1c1
Sequence:CCGGGACTCGACTGTAAGGACAAATCTCGAGATTTGTCCTTACAGTCGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033049.1-467s1c1
Sequence:CCGGCCACAGAAGACAATCAATCATCTCGAGATGATTGATTGTCTTCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033049.1-113s1c1
Sequence:CCGGCAACCACAGAAACTGCGACTACTCGAGTAGTCGCAGTTTCTGTGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033049.1-1144s1c1
Sequence:CCGGGCACAGCACAAGCAATGCTTACTCGAGTAAGCATTGCTTGTGCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033049.1-92s1c1
Sequence:CCGGGCAACTCAGCTGATGCTGTAACTCGAGTTACAGCATCAGCTGAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033049
MUC13 MISSION shRNA shRNA Plasmid DNA
mucin 13, cell surface associated
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033049.2-1949s21c1
Sequence:CCGGTTGAGTTAAGTGACCTAATTCCTCGAGGAATTAGGTCACTTAACTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033049.2-1595s21c1
Sequence:CCGGACCAATGTACAAGCTATTATTCTCGAGAATAATAGCTTGTACATTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033049.1-714s1c1
Sequence:CCGGCCCAGAAGAGAAACATTCCATCTCGAGATGGAATGTTTCTCTTCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033049.1-1393s1c1
Sequence:CCGGGAAGAGAACTTGATTGACGAACTCGAGTTCGTCAATCAAGTTCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033049.1-569s1c1
Sequence:CCGGCCTGTGCAGATAATTCGTTATCTCGAGATAACGAATTATCTGCACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033049.1-1262s1c1
Sequence:CCGGGACTCGACTGTAAGGACAAATCTCGAGATTTGTCCTTACAGTCGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033049.1-467s1c1
Sequence:CCGGCCACAGAAGACAATCAATCATCTCGAGATGATTGATTGTCTTCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033049.1-113s1c1
Sequence:CCGGCAACCACAGAAACTGCGACTACTCGAGTAGTCGCAGTTTCTGTGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033049.1-1144s1c1
Sequence:CCGGGCACAGCACAAGCAATGCTTACTCGAGTAAGCATTGCTTGTGCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033049.1-92s1c1
Sequence:CCGGGCAACTCAGCTGATGCTGTAACTCGAGTTACAGCATCAGCTGAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033049
MUC13 MISSION shRNA Lentiviral Transduction Particles
mucin 13, cell surface associated
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033049.2-1949s21c1
Sequence:CCGGTTGAGTTAAGTGACCTAATTCCTCGAGGAATTAGGTCACTTAACTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033049.2-1595s21c1
Sequence:CCGGACCAATGTACAAGCTATTATTCTCGAGAATAATAGCTTGTACATTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033049.1-714s1c1
Sequence:CCGGCCCAGAAGAGAAACATTCCATCTCGAGATGGAATGTTTCTCTTCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033049.1-1393s1c1
Sequence:CCGGGAAGAGAACTTGATTGACGAACTCGAGTTCGTCAATCAAGTTCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033049.1-569s1c1
Sequence:CCGGCCTGTGCAGATAATTCGTTATCTCGAGATAACGAATTATCTGCACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033049.1-1262s1c1
Sequence:CCGGGACTCGACTGTAAGGACAAATCTCGAGATTTGTCCTTACAGTCGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033049.1-467s1c1
Sequence:CCGGCCACAGAAGACAATCAATCATCTCGAGATGATTGATTGTCTTCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033049.1-113s1c1
Sequence:CCGGCAACCACAGAAACTGCGACTACTCGAGTAGTCGCAGTTTCTGTGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033049.1-1144s1c1
Sequence:CCGGGCACAGCACAAGCAATGCTTACTCGAGTAAGCATTGCTTGTGCTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033049.1-92s1c1
Sequence:CCGGGCAACTCAGCTGATGCTGTAACTCGAGTTACAGCATCAGCTGAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010739
MUC13 MISSION shRNA Bacterial Glycerol Stock
mucin 13, cell surface associated
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010739.2-1795s21c1
Sequence:CCGGAGACCGGCTTCTCCAACTTAGCTCGAGCTAAGTTGGAGAAGCCGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010739.2-1232s21c1
Sequence:CCGGCGTCAGTGTATCCGTAGTAAACTCGAGTTTACTACGGATACACTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010739.2-1299s1c1
Sequence:CCGGGCAATCGAAACTGCAATTAAGCTCGAGCTTAATTGCAGTTTCGATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010739.2-1232s1c1
Sequence:CCGGCGTCAGTGTATCCGTAGTAAACTCGAGTTTACTACGGATACACTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010739.2-1707s21c1
Sequence:CCGGATCGTCTCTGCGAGGTCAAAGCTCGAGCTTTGACCTCGCAGAGACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010739.2-1299s21c1
Sequence:CCGGGCAATCGAAACTGCAATTAAGCTCGAGCTTAATTGCAGTTTCGATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010739.2-2073s21c1
Sequence:CCGGCCGAAGACACACCTATCAAATCTCGAGATTTGATAGGTGTGTCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175392    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_010739.1-2073s1c1
Sequence:CCGGCCGAAGACACACCTATCAAATCTCGAGATTTGATAGGTGTGTCTTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010739.1-931s1c1
Sequence:CCGGCTTCTTGTGTTAAGCTGCATACTCGAGTATGCAGCTTAACACAAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173927    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_010739.1-2072s1c1
Sequence:CCGGGCCGAAGACACACCTATCAAACTCGAGTTTGATAGGTGTGTCTTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010739
MUC13 MISSION shRNA shRNA Plasmid DNA
mucin 13, cell surface associated
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010739.2-1795s21c1
Sequence:CCGGAGACCGGCTTCTCCAACTTAGCTCGAGCTAAGTTGGAGAAGCCGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010739.2-1232s21c1
Sequence:CCGGCGTCAGTGTATCCGTAGTAAACTCGAGTTTACTACGGATACACTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010739.2-1299s1c1
Sequence:CCGGGCAATCGAAACTGCAATTAAGCTCGAGCTTAATTGCAGTTTCGATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010739.2-1232s1c1
Sequence:CCGGCGTCAGTGTATCCGTAGTAAACTCGAGTTTACTACGGATACACTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010739.2-1707s21c1
Sequence:CCGGATCGTCTCTGCGAGGTCAAAGCTCGAGCTTTGACCTCGCAGAGACGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010739.2-1299s21c1
Sequence:CCGGGCAATCGAAACTGCAATTAAGCTCGAGCTTAATTGCAGTTTCGATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010739.2-2073s21c1
Sequence:CCGGCCGAAGACACACCTATCAAATCTCGAGATTTGATAGGTGTGTCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175392    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_010739.1-2073s1c1
Sequence:CCGGCCGAAGACACACCTATCAAATCTCGAGATTTGATAGGTGTGTCTTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010739.1-931s1c1
Sequence:CCGGCTTCTTGTGTTAAGCTGCATACTCGAGTATGCAGCTTAACACAAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173927    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_010739.1-2072s1c1
Sequence:CCGGGCCGAAGACACACCTATCAAACTCGAGTTTGATAGGTGTGTCTTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010739
MUC13 MISSION shRNA Lentiviral Transduction Particles
mucin 13, cell surface associated
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010739.2-1795s21c1
Sequence:CCGGAGACCGGCTTCTCCAACTTAGCTCGAGCTAAGTTGGAGAAGCCGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010739.2-1232s21c1
Sequence:CCGGCGTCAGTGTATCCGTAGTAAACTCGAGTTTACTACGGATACACTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010739.2-1299s1c1
Sequence:CCGGGCAATCGAAACTGCAATTAAGCTCGAGCTTAATTGCAGTTTCGATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010739.2-1232s1c1
Sequence:CCGGCGTCAGTGTATCCGTAGTAAACTCGAGTTTACTACGGATACACTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010739.2-1707s21c1
Sequence:CCGGATCGTCTCTGCGAGGTCAAAGCTCGAGCTTTGACCTCGCAGAGACGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010739.2-1299s21c1
Sequence:CCGGGCAATCGAAACTGCAATTAAGCTCGAGCTTAATTGCAGTTTCGATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010739.2-2073s21c1
Sequence:CCGGCCGAAGACACACCTATCAAATCTCGAGATTTGATAGGTGTGTCTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175392    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_010739.1-2073s1c1
Sequence:CCGGCCGAAGACACACCTATCAAATCTCGAGATTTGATAGGTGTGTCTTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010739.1-931s1c1
Sequence:CCGGCTTCTTGTGTTAAGCTGCATACTCGAGTATGCAGCTTAACACAAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173927    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_010739.1-2072s1c1
Sequence:CCGGGCCGAAGACACACCTATCAAACTCGAGTTTGATAGGTGTGTCTTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)