EMAIL THIS PAGE TO A FRIEND

MUC15

mucin 15, cell surface associated

60 Gene Product Result for
Synonyms: MUC-15 PAS3 PASIII
UniProtKB ID: Q8N387, B3KY00, Q6UWS3, Q8IXI8, Q8WW41
Gene ID:
Mouse(269328) mucin 15
Rat(690914) mucin 15, cell surface associated
domestic cat(101080915) mucin 15, cell surface associated
cow(337919) mucin 15, cell surface associated
naked mole-rat(101701015) mucin 15, cell surface associated
sheep(101115062) mucin 15, cell surface associated
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172979 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172979 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172979 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145650 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145650 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145650 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU060491 MISSION® esiRNA esiRNA human MUC15 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145650 Rosetta Predictions human pricing
NM_001044301 Rosetta Predictions rat pricing
NM_172979 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145650 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199076 predicted 894
2 SASI_Hs01_00199078 predicted 938
3 SASI_Hs02_00365269 predicted 1172
4 SASI_Hs01_00199079 predicted 1130
5 SASI_Hs02_00365270 predicted 597
6 SASI_Hs01_00199080 predicted 1306
7 SASI_Hs01_00199082 predicted 1221
8 SASI_Hs01_00199083 predicted 1337
9 SASI_Hs01_00199084 predicted 866
10 SASI_Hs01_00199085 predicted 583
11 SASI_Hs01_00199077 predicted 557
12 SASI_Hs01_00199081 predicted 1016
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044301 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205674 predicted 896
2 SASI_Rn02_00205675 predicted 997
3 SASI_Rn02_00205676 predicted 250
4 SASI_Rn02_00205677 predicted 612
5 SASI_Rn02_00205678 predicted 404
6 SASI_Rn02_00205679 predicted 1053
7 SASI_Rn02_00205680 predicted 1104
8 SASI_Rn02_00205681 predicted 697
9 SASI_Rn02_00205682 predicted 988
10 SASI_Rn02_00205683 predicted 846
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172979 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108674 predicted 1175
2 SASI_Mm01_00108675 predicted 886
3 SASI_Mm01_00108676 predicted 982
4 SASI_Mm01_00108677 predicted 318
5 SASI_Mm01_00108678 predicted 336
6 SASI_Mm01_00108679 predicted 1043
7 SASI_Mm02_00345026 predicted 346
8 SASI_Mm01_00108681 predicted 310
9 SASI_Mm01_00108682 predicted 277
10 SASI_Mm01_00108683 predicted 973
11 SASI_Mm01_00108680 predicted 444
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172979
MUC15 MISSION shRNA Bacterial Glycerol Stock
mucin 15, cell surface associated
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000174608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172979.1-1331s1c1
Sequence:CCGGGCTGAAGCATGTGTTATACAACTCGAGTTGTATAACACATGCTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172979.1-534s1c1
Sequence:CCGGCGAACATTCCAATTCTACAAACTCGAGTTTGTAGAATTGGAATGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172979.1-979s1c1
Sequence:CCGGCGATTAGACAATGCACCAGAACTCGAGTTCTGGTGCATTGTCTAATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172979.1-752s1c1
Sequence:CCGGCAACTTTACAACCTACACTAACTCGAGTTAGTGTAGGTTGTAAAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172979
MUC15 MISSION shRNA shRNA Plasmid DNA
mucin 15, cell surface associated
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000174608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172979.1-1331s1c1
Sequence:CCGGGCTGAAGCATGTGTTATACAACTCGAGTTGTATAACACATGCTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172979.1-534s1c1
Sequence:CCGGCGAACATTCCAATTCTACAAACTCGAGTTTGTAGAATTGGAATGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172979.1-979s1c1
Sequence:CCGGCGATTAGACAATGCACCAGAACTCGAGTTCTGGTGCATTGTCTAATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172979.1-752s1c1
Sequence:CCGGCAACTTTACAACCTACACTAACTCGAGTTAGTGTAGGTTGTAAAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172979
MUC15 MISSION shRNA Lentiviral Transduction Particles
mucin 15, cell surface associated
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000174608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172979.1-1331s1c1
Sequence:CCGGGCTGAAGCATGTGTTATACAACTCGAGTTGTATAACACATGCTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172979.1-534s1c1
Sequence:CCGGCGAACATTCCAATTCTACAAACTCGAGTTTGTAGAATTGGAATGTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172979.1-979s1c1
Sequence:CCGGCGATTAGACAATGCACCAGAACTCGAGTTCTGGTGCATTGTCTAATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172979.1-752s1c1
Sequence:CCGGCAACTTTACAACCTACACTAACTCGAGTTAGTGTAGGTTGTAAAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145650
MUC15 MISSION shRNA Bacterial Glycerol Stock
mucin 15, cell surface associated
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130486    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145650.2-1624s1c1
Sequence:CCGGGCCCTGCCTCATAACTAAATACTCGAGTATTTAGTTATGAGGCAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145650.2-1184s1c1
Sequence:CCGGCCGGAACCTTATGATGTGAGTCTCGAGACTCACATCATAAGGTTCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145650.2-1169s1c1
Sequence:CCGGCGATTAGACAATGCACCGGAACTCGAGTTCCGGTGCATTGTCTAATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129091    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145650.2-1351s1c1
Sequence:CCGGGCAAGTGTCATCTACATCCTACTCGAGTAGGATGTAGATGACACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129044    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145650.2-1918s1c1
Sequence:CCGGGCTGACAATGACTGCATTCAACTCGAGTTGAATGCAGTCATTGTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145650.2-677s1c1
Sequence:CCGGGTGCCTTGGAATGCACCTATACTCGAGTATAGGTGCATTCCAAGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128885    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145650.2-1341s1c1
Sequence:CCGGGCGTTAAACAGCAAGTGTCATCTCGAGATGACACTTGCTGTTTAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145650.2-942s1c1
Sequence:CCGGCAACTCTACAGCCTACCTTAACTCGAGTTAAGGTAGGCTGTAGAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145650.3-1569s21c1
Sequence:CCGGCAGCCCTGCCTCATAACTAAACTCGAGTTTAGTTATGAGGCAGGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145650.3-499s21c1
Sequence:CCGGCCAACAACAGCCACGGAATAACTCGAGTTATTCCGTGGCTGTTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145650.3-1652s21c1
Sequence:CCGGTGAAGCCCTAGTACCATAATTCTCGAGAATTATGGTACTAGGGCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145650
MUC15 MISSION shRNA shRNA Plasmid DNA
mucin 15, cell surface associated
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130486    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145650.2-1624s1c1
Sequence:CCGGGCCCTGCCTCATAACTAAATACTCGAGTATTTAGTTATGAGGCAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145650.2-1184s1c1
Sequence:CCGGCCGGAACCTTATGATGTGAGTCTCGAGACTCACATCATAAGGTTCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145650.2-1169s1c1
Sequence:CCGGCGATTAGACAATGCACCGGAACTCGAGTTCCGGTGCATTGTCTAATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129091    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145650.2-1351s1c1
Sequence:CCGGGCAAGTGTCATCTACATCCTACTCGAGTAGGATGTAGATGACACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129044    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145650.2-1918s1c1
Sequence:CCGGGCTGACAATGACTGCATTCAACTCGAGTTGAATGCAGTCATTGTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145650.2-677s1c1
Sequence:CCGGGTGCCTTGGAATGCACCTATACTCGAGTATAGGTGCATTCCAAGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128885    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145650.2-1341s1c1
Sequence:CCGGGCGTTAAACAGCAAGTGTCATCTCGAGATGACACTTGCTGTTTAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145650.2-942s1c1
Sequence:CCGGCAACTCTACAGCCTACCTTAACTCGAGTTAAGGTAGGCTGTAGAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145650.3-1569s21c1
Sequence:CCGGCAGCCCTGCCTCATAACTAAACTCGAGTTTAGTTATGAGGCAGGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145650.3-499s21c1
Sequence:CCGGCCAACAACAGCCACGGAATAACTCGAGTTATTCCGTGGCTGTTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145650.3-1652s21c1
Sequence:CCGGTGAAGCCCTAGTACCATAATTCTCGAGAATTATGGTACTAGGGCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145650
MUC15 MISSION shRNA Lentiviral Transduction Particles
mucin 15, cell surface associated
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130486    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145650.2-1624s1c1
Sequence:CCGGGCCCTGCCTCATAACTAAATACTCGAGTATTTAGTTATGAGGCAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145650.2-1184s1c1
Sequence:CCGGCCGGAACCTTATGATGTGAGTCTCGAGACTCACATCATAAGGTTCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145650.2-1169s1c1
Sequence:CCGGCGATTAGACAATGCACCGGAACTCGAGTTCCGGTGCATTGTCTAATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129091    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145650.2-1351s1c1
Sequence:CCGGGCAAGTGTCATCTACATCCTACTCGAGTAGGATGTAGATGACACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129044    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145650.2-1918s1c1
Sequence:CCGGGCTGACAATGACTGCATTCAACTCGAGTTGAATGCAGTCATTGTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145650.2-677s1c1
Sequence:CCGGGTGCCTTGGAATGCACCTATACTCGAGTATAGGTGCATTCCAAGGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128885    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145650.2-1341s1c1
Sequence:CCGGGCGTTAAACAGCAAGTGTCATCTCGAGATGACACTTGCTGTTTAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145650.2-942s1c1
Sequence:CCGGCAACTCTACAGCCTACCTTAACTCGAGTTAAGGTAGGCTGTAGAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145650.3-1569s21c1
Sequence:CCGGCAGCCCTGCCTCATAACTAAACTCGAGTTTAGTTATGAGGCAGGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145650.3-499s21c1
Sequence:CCGGCCAACAACAGCCACGGAATAACTCGAGTTATTCCGTGGCTGTTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145650.3-1652s21c1
Sequence:CCGGTGAAGCCCTAGTACCATAATTCTCGAGAATTATGGTACTAGGGCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)