EMAIL THIS PAGE TO A FRIEND

MUC17

mucin 17, cell surface associated

32 Gene Product Result for
Synonyms: MUC3
Species: Human MUC17(140453), naked mole-rat Muc17(101719089)
UniProtKB ID: Q685J3, O14761, Q685J2, Q8TDH7
Gene ID:
Human(140453) Summary: Membrane mucins, such as MUC17, function in epithelial cells to provide cytoprotection, maintain luminal structure, provide signal transduction, and confer antiadhesive properties upon cancer cells that lose their apical/basal polarization.[supplied by OMIM, Apr 2004]
naked mole-rat(101719089) mucin 17, cell surface associated
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004430 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004430 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004430 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU139231 MISSION® esiRNA esiRNA human MUC17 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040105 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040105 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179788 predicted 4222
2 SASI_Hs01_00179789 predicted 10945
3 SASI_Hs01_00179790 predicted 7185
4 SASI_Hs02_00308826 predicted 6322
5 SASI_Hs02_00308827 predicted 5284
6 SASI_Hs02_00308828 predicted 11596
7 SASI_Hs01_00179792 predicted 6842
8 SASI_Hs01_00179793 predicted 11627
9 SASI_Hs02_00308829 predicted 11980
10 SASI_Hs02_00308830 predicted 12578
11 SASI_Hs01_00179791 predicted 2770
12 SASI_Hs01_00179794 predicted 11947
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004430
MUC17 MISSION shRNA Bacterial Glycerol Stock
mucin 17, cell surface associated
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004430.1-6511s1c1
Sequence:CCGGCCTCAACTTATAGTGACAGAACTCGAGTTCTGTCACTATAAGTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004430.1-11956s1c1
Sequence:CCGGCCACTGAACTAAACACACCATCTCGAGATGGTGTGTTTAGTTCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004430.1-1681s1c1
Sequence:CCGGCCACTTCTAGTGAAGCCAGTTCTCGAGAACTGGCTTCACTAGAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004430.1-1150s1c1
Sequence:CCGGCCACTTCTACTGAACCCAGTTCTCGAGAACTGGGTTCAGTAGAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140287    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004430.1-13603s1c1
Sequence:CCGGGCTAGGCTTTCCTGCTCATTTCTCGAGAAATGAGCAGGAAAGCCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004430.1-495s1c1
Sequence:CCGGCCCATGTCAACACCAAGTGAACTCGAGTTCACTTGGTGTTGACATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004430.1-10345s1c1
Sequence:CCGGCCACTTCTACTGAAGCCAGTTCTCGAGAACTGGCTTCAGTAGAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004430.1-619s1c1
Sequence:CCGGCCACTTCTACTCAGGCAAGTTCTCGAGAACTTGCCTGAGTAGAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004430.1-13329s1c1
Sequence:CCGGCCCTGAAACAAAGATCCGAATCTCGAGATTCGGATCTTTGTTTCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122123    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004430.1-13683s1c1
Sequence:CCGGGCCAGGATTGATTTGGTTGATCTCGAGATCAACCAAATCAATCCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004430.1-11372s1c1
Sequence:CCGGCCCTTCCATACCATCTGTTTACTCGAGTAAACAGATGGTATGGAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004430
MUC17 MISSION shRNA shRNA Plasmid DNA
mucin 17, cell surface associated
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004430.1-6511s1c1
Sequence:CCGGCCTCAACTTATAGTGACAGAACTCGAGTTCTGTCACTATAAGTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004430.1-11956s1c1
Sequence:CCGGCCACTGAACTAAACACACCATCTCGAGATGGTGTGTTTAGTTCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004430.1-1681s1c1
Sequence:CCGGCCACTTCTAGTGAAGCCAGTTCTCGAGAACTGGCTTCACTAGAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004430.1-1150s1c1
Sequence:CCGGCCACTTCTACTGAACCCAGTTCTCGAGAACTGGGTTCAGTAGAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140287    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004430.1-13603s1c1
Sequence:CCGGGCTAGGCTTTCCTGCTCATTTCTCGAGAAATGAGCAGGAAAGCCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004430.1-495s1c1
Sequence:CCGGCCCATGTCAACACCAAGTGAACTCGAGTTCACTTGGTGTTGACATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004430.1-10345s1c1
Sequence:CCGGCCACTTCTACTGAAGCCAGTTCTCGAGAACTGGCTTCAGTAGAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004430.1-619s1c1
Sequence:CCGGCCACTTCTACTCAGGCAAGTTCTCGAGAACTTGCCTGAGTAGAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004430.1-13329s1c1
Sequence:CCGGCCCTGAAACAAAGATCCGAATCTCGAGATTCGGATCTTTGTTTCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122123    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004430.1-13683s1c1
Sequence:CCGGGCCAGGATTGATTTGGTTGATCTCGAGATCAACCAAATCAATCCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004430.1-11372s1c1
Sequence:CCGGCCCTTCCATACCATCTGTTTACTCGAGTAAACAGATGGTATGGAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004430
MUC17 MISSION shRNA Lentiviral Transduction Particles
mucin 17, cell surface associated
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004430.1-6511s1c1
Sequence:CCGGCCTCAACTTATAGTGACAGAACTCGAGTTCTGTCACTATAAGTTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004430.1-11956s1c1
Sequence:CCGGCCACTGAACTAAACACACCATCTCGAGATGGTGTGTTTAGTTCAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004430.1-1681s1c1
Sequence:CCGGCCACTTCTAGTGAAGCCAGTTCTCGAGAACTGGCTTCACTAGAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004430.1-1150s1c1
Sequence:CCGGCCACTTCTACTGAACCCAGTTCTCGAGAACTGGGTTCAGTAGAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140287    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004430.1-13603s1c1
Sequence:CCGGGCTAGGCTTTCCTGCTCATTTCTCGAGAAATGAGCAGGAAAGCCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004430.1-495s1c1
Sequence:CCGGCCCATGTCAACACCAAGTGAACTCGAGTTCACTTGGTGTTGACATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004430.1-10345s1c1
Sequence:CCGGCCACTTCTACTGAAGCCAGTTCTCGAGAACTGGCTTCAGTAGAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004430.1-619s1c1
Sequence:CCGGCCACTTCTACTCAGGCAAGTTCTCGAGAACTTGCCTGAGTAGAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004430.1-13329s1c1
Sequence:CCGGCCCTGAAACAAAGATCCGAATCTCGAGATTCGGATCTTTGTTTCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122123    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004430.1-13683s1c1
Sequence:CCGGGCCAGGATTGATTTGGTTGATCTCGAGATCAACCAAATCAATCCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004430.1-11372s1c1
Sequence:CCGGCCCTTCCATACCATCTGTTTACTCGAGTAAACAGATGGTATGGAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)