EMAIL THIS PAGE TO A FRIEND

MUC19

mucin 19, oligomeric

79 Gene Product Result for
Synonyms: MUC-19
UniProtKB ID: Q7Z5P9, Q8NA85
Gene ID:
Mouse(239611) mucin 19
Rat(315239) mucin 19
dog(609857) mucin 19, oligomeric
cow(100140959) mucin 19
domestic guinea pig(100731405) mucin 19, oligomeric
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207243 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207243 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207243 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001714368 Rosetta Predictions human pricing
XM_495921 Rosetta Predictions human pricing
XM_497341 Rosetta Predictions human pricing
XM_936590 Rosetta Predictions human pricing
XM_001057170 Rosetta Predictions rat pricing
XM_235593 Rosetta Predictions rat pricing
NM_207243 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714368 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00396627 predicted 4317
2 SASI_Hs02_00396628 predicted 4157
3 SASI_Hs02_00396629 predicted 2874
4 SASI_Hs02_00396630 predicted 1148
5 SASI_Hs02_00396631 predicted 1696
6 SASI_Hs02_00396632 predicted 4712
7 SASI_Hs02_00396633 predicted 4169
8 SASI_Hs02_00396634 predicted 1810
9 SASI_Hs02_00396635 predicted 2700
10 SASI_Hs02_00396636 predicted 3253
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_495921 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00262471 predicted 1426
2 SASI_Hs01_00262472 predicted 1490
3 SASI_Hs01_00262473 predicted 1612
4 SASI_Hs01_00262474 predicted 1569
5 SASI_Hs01_00262475 predicted 1617
6 SASI_Hs01_00262476 predicted 1499
7 SASI_Hs01_00262477 predicted 1612
8 SASI_Hs01_00262478 predicted 1565
9 SASI_Hs01_00262479 predicted 1650
10 SASI_Hs01_00262480 predicted 1511
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_497341 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00280528 predicted 1150
2 SASI_Hs02_00480093 predicted 2646
3 SASI_Hs02_00480094 predicted 2969
4 SASI_Hs02_00480095 predicted 942
5 SASI_Hs02_00480096 predicted 2816
6 SASI_Hs01_00280531 predicted 1535
7 SASI_Hs02_00480097 predicted 3466
8 SASI_Hs01_00280534 predicted 3375
9 SASI_Hs01_00280535 predicted 2834
10 SASI_Hs01_00280537 predicted 1355
11 SASI_Hs01_00280529 predicted 6469
12 SASI_Hs01_00280530 predicted 966
13 SASI_Hs01_00280532 predicted 1155
14 SASI_Hs01_00280533 predicted 1706
15 SASI_Hs01_00280536 predicted 1827
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_936590 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00482133 predicted 1146
2 SASI_Hs02_00482134 predicted 2651
3 SASI_Hs02_00482135 predicted 2974
4 SASI_Hs02_00482136 predicted 942
5 SASI_Hs02_00482137 predicted 2813
6 SASI_Hs02_00482138 predicted 1528
7 SASI_Hs02_00482139 predicted 3467
8 SASI_Hs02_00482140 predicted 3374
9 SASI_Hs02_00482141 predicted 2834
10 SASI_Hs02_00482142 predicted 1358
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057170 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00285656 predicted 3242
2 SASI_Rn02_00285657 predicted 1457
3 SASI_Rn02_00285658 predicted 2221
4 SASI_Rn02_00285659 predicted 1884
5 SASI_Rn02_00285660 predicted 3870
6 SASI_Rn02_00285661 predicted 2810
7 SASI_Rn02_00285662 predicted 1117
8 SASI_Rn02_00285663 predicted 1420
9 SASI_Rn02_00285664 predicted 2930
10 SASI_Rn02_00285665 predicted 1059
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235593 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389509 predicted 510
2 SASI_Rn02_00389510 predicted 3168
3 SASI_Rn02_00389511 predicted 514
4 SASI_Rn02_00389512 predicted 4765
5 SASI_Rn02_00389513 predicted 3172
6 SASI_Rn02_00389514 predicted 1275
7 SASI_Rn02_00389515 predicted 2267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207243 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351979 predicted 391
2 SASI_Mm01_00160567 predicted 3238
3 SASI_Mm01_00160569 predicted 22506
4 SASI_Mm01_00160570 predicted 831
5 SASI_Mm01_00160571 predicted 370
6 SASI_Mm01_00160572 predicted 1173
7 SASI_Mm01_00160573 predicted 617
8 SASI_Mm01_00160574 predicted 21984
9 SASI_Mm01_00160575 predicted 1407
10 SASI_Mm01_00160576 predicted 790
11 SASI_Mm01_00160568 predicted 2933
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207243
MUC19 MISSION shRNA Bacterial Glycerol Stock
mucin 19, oligomeric
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207243.2-22635s1c1
Sequence:CCGGCCGGTTGCTCTTATTCTAGAACTCGAGTTCTAGAATAAGAGCAACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207243.2-2277s1c1
Sequence:CCGGCCCTTGATTTAACCCTACAAACTCGAGTTTGTAGGGTTAAATCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207243.2-3681s1c1
Sequence:CCGGGCAGTGAAACTCCTCCAAATTCTCGAGAATTTGGAGGAGTTTCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207243.2-22047s1c1
Sequence:CCGGGCAAACCTAAAGAGTGTCCTTCTCGAGAAGGACACTCTTTAGGTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207243.2-998s1c1
Sequence:CCGGGCTCCCTTTCAAGACAGTGAACTCGAGTTCACTGTCTTGAAAGGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207243
MUC19 MISSION shRNA shRNA Plasmid DNA
mucin 19, oligomeric
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207243.2-22635s1c1
Sequence:CCGGCCGGTTGCTCTTATTCTAGAACTCGAGTTCTAGAATAAGAGCAACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207243.2-2277s1c1
Sequence:CCGGCCCTTGATTTAACCCTACAAACTCGAGTTTGTAGGGTTAAATCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207243.2-3681s1c1
Sequence:CCGGGCAGTGAAACTCCTCCAAATTCTCGAGAATTTGGAGGAGTTTCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207243.2-22047s1c1
Sequence:CCGGGCAAACCTAAAGAGTGTCCTTCTCGAGAAGGACACTCTTTAGGTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207243.2-998s1c1
Sequence:CCGGGCTCCCTTTCAAGACAGTGAACTCGAGTTCACTGTCTTGAAAGGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207243
MUC19 MISSION shRNA Lentiviral Transduction Particles
mucin 19, oligomeric
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207243.2-22635s1c1
Sequence:CCGGCCGGTTGCTCTTATTCTAGAACTCGAGTTCTAGAATAAGAGCAACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207243.2-2277s1c1
Sequence:CCGGCCCTTGATTTAACCCTACAAACTCGAGTTTGTAGGGTTAAATCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207243.2-3681s1c1
Sequence:CCGGGCAGTGAAACTCCTCCAAATTCTCGAGAATTTGGAGGAGTTTCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207243.2-22047s1c1
Sequence:CCGGGCAAACCTAAAGAGTGTCCTTCTCGAGAAGGACACTCTTTAGGTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207243.2-998s1c1
Sequence:CCGGGCTCCCTTTCAAGACAGTGAACTCGAGTTCACTGTCTTGAAAGGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)