EMAIL THIS PAGE TO A FRIEND

MUC1

mucin 1, cell surface associated

166 Gene Product Result for
Synonyms: CA 15-3 CD227 EMA H23AG KL-6 MAM6 MCKD1 MUC-1 MUC-1/SEC MUC-1/X MUC1/ZD PEM PEMT PUM
Gene ID:
Human(4582) Summary: This gene encodes a membrane-bound protein that is a member of the mucin family. Mucins are O-glycosylated proteins that play an essential role in forming protective mucous barriers on epithelial surfaces. These proteins also play a role in intracellular signaling. This protein is expressed on the apical surface of epithelial cells that line the mucosal surfaces of many different tissues including lung, breast stomach and pancreas. This protein is proteolytically cleaved into alpha and beta subunits that form a heterodimeric complex. The N-terminal alpha subunit functions in cell-adhesion and the C-terminal beta subunit is involved in cell signaling. Overexpression, aberrant intracellular localization, and changes in glycosylation of this protein have been associated with carcinomas. This gene is known to contain a highly polymorphic variable number tandem repeats (VNTR) domain. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Feb 2011]
Mouse(17829) mucin 1, transmembrane
Rat(24571) mucin 1, cell surface associated
chicken(426412) mucin 1, cell surface associated
cow(281333) mucin 1, cell surface associated
domestic cat(100294522) mucin 1, cell surface associated
domestic cat(101093832) mucin 1, cell surface associated
dog(448784) mucin 1, cell surface associated
sheep(101106133) mucin 1, cell surface associated
sheep(100294589) mucin 1, cell surface associated
domestic guinea pig(100733534) mucin 1, cell surface associated
naked mole-rat(101702421) mucin 1, cell surface associated
Domestic Rabbit(100009240) mucin 1, cell surface associated
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501931 Anti-CD227 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunofluorescence, immunohistochemistry pricing
SAB4501932 Anti-CD227 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, immunohistochemistry pricing
SAB2108549 Anti-MUC1 affinity isolated antibody mouse, rabbit, guinea pig, human, dog, horse, rat
immunohistochemistry, western blot pricing
SAB2101530 Anti-MUC1 (ab2) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
AV41446 Anti-MUC1 (AB2) antibody produced in rabbit IgG fraction of antiserum human, dog
immunohistochemistry, western blot pricing
GW22681 Anti-MUC1 antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, human, rat
immunohistochemistry, western blot pricing
HPA004179 Anti-MUC1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry pricing
HPA007235 Anti-MUC1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA008855 Anti-MUC1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry pricing
SAB2101529 Anti-MUC1 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4501933 Anti-MUC1 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, immunohistochemistry pricing
AV41445 Anti-MUC1(AB1) antibody produced in rabbit affinity isolated antibody rabbit, guinea pig, pig, canine, bovine, mouse, rat, human, horse, rabbit
immunohistochemistry, western blot pricing
SAB4504300 Anti-phospho-CD227/MUC1 (pTyr1229) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
E0143 Monoclonal Anti-Episialin (EMA) antibody produced in mouse clone GP1.4, ascites fluid human
immunohistochemistry, immunoprecipitation (IP), microarray pricing
WH0004582M1 Monoclonal Anti-MUC1 antibody produced in mouse clone 3B9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4200017 Monoclonal Anti-MUC1 antibody produced in mouse ~1.0 mg/mL, clone 1D1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunocytochemistry, immunoprecipitation (IP), radioimmunoassay, western blot pricing
SAB1404092 Monoclonal Anti-MUC1 antibody produced in mouse clone 1B7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002456 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002456 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002456 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013605 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013605 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013605 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU095251 MISSION® esiRNA esiRNA human MUC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001018016 Rosetta Predictions human pricing
NM_001018017 Rosetta Predictions human pricing
NM_001018021 Rosetta Predictions human pricing
NM_001044390 Rosetta Predictions human pricing
NM_001044391 Rosetta Predictions human pricing
NM_001044392 Rosetta Predictions human pricing
NM_001044393 Rosetta Predictions human pricing
NM_002456 Rosetta Predictions human pricing
NM_012602 Rosetta Predictions rat pricing
NM_013605 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018016 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306905 predicted 839
2 SASI_Hs02_00306906 predicted 831
3 SASI_Hs01_00081854 predicted 840
4 SASI_Hs02_00306907 predicted 863
5 SASI_Hs02_00306908 predicted 939
6 SASI_Hs02_00306909 predicted 935
7 SASI_Hs02_00306910 predicted 872
8 SASI_Hs02_00306911 predicted 877
9 SASI_Hs02_00306912 predicted 905
10 SASI_Hs02_00306913 predicted 861
11 SASI_Hs01_00081849 predicted 481
12 SASI_Hs01_00081850 predicted 636
13 SASI_Hs01_00081851 predicted 700
14 SASI_Hs01_00081852 predicted 645
15 SASI_Hs01_00081853 predicted 494
16 SASI_Hs01_00081855 predicted 783
17 SASI_Hs01_00081856 predicted 688
18 SASI_Hs01_00081857 predicted 471
19 SASI_Hs01_00081858 predicted 485
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018017 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306914 predicted 806
2 SASI_Hs02_00306915 predicted 809
3 SASI_Hs01_00218184 predicted 804
4 SASI_Hs02_00306916 predicted 836
5 SASI_Hs02_00306917 predicted 903
6 SASI_Hs02_00306918 predicted 911
7 SASI_Hs02_00306919 predicted 839
8 SASI_Hs02_00306920 predicted 853
9 SASI_Hs02_00306921 predicted 869
10 SASI_Hs02_00306922 predicted 828
11 SASI_Hs01_00218179 predicted 455
12 SASI_Hs01_00218180 predicted 616
13 SASI_Hs01_00218181 predicted 666
14 SASI_Hs01_00218182 predicted 618
15 SASI_Hs01_00218183 predicted 470
16 SASI_Hs01_00218185 predicted 758
17 SASI_Hs01_00218186 predicted 666
18 SASI_Hs01_00218187 predicted 440
19 SASI_Hs01_00218188 predicted 460
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018021 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241136 predicted 798
2 SASI_Hs01_00241137 predicted 437
3 SASI_Hs01_00241138 predicted 597
4 SASI_Hs01_00241139 predicted 655
5 SASI_Hs01_00241140 predicted 599
6 SASI_Hs01_00241141 predicted 446
7 SASI_Hs01_00241142 predicted 794
8 SASI_Hs01_00241143 predicted 736
9 SASI_Hs01_00241144 predicted 643
10 SASI_Hs01_00241145 predicted 433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044390 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311362 predicted 658
2 SASI_Hs02_00311363 predicted 652
3 SASI_Hs02_00311364 predicted 653
4 SASI_Hs02_00311365 predicted 673
5 SASI_Hs02_00311366 predicted 747
6 SASI_Hs02_00311367 predicted 755
7 SASI_Hs02_00311368 predicted 682
8 SASI_Hs02_00311369 predicted 693
9 SASI_Hs02_00311370 predicted 719
10 SASI_Hs02_00311371 predicted 679
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044391 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311372 predicted 497
2 SASI_Hs02_00311373 predicted 492
3 SASI_Hs02_00311374 predicted 494
4 SASI_Hs02_00311375 predicted 517
5 SASI_Hs02_00311376 predicted 596
6 SASI_Hs02_00311377 predicted 597
7 SASI_Hs02_00311378 predicted 530
8 SASI_Hs02_00311379 predicted 539
9 SASI_Hs02_00311380 predicted 554
10 SASI_Hs02_00311381 predicted 516
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044392 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311382 predicted 525
2 SASI_Hs02_00311383 predicted 523
3 SASI_Hs02_00311384 predicted 524
4 SASI_Hs02_00311385 predicted 546
5 SASI_Hs02_00311386 predicted 624
6 SASI_Hs02_00311387 predicted 626
7 SASI_Hs02_00311388 predicted 555
8 SASI_Hs02_00311389 predicted 567
9 SASI_Hs02_00311390 predicted 590
10 SASI_Hs02_00311391 predicted 545
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044393 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311392 predicted 619
2 SASI_Hs02_00311393 predicted 622
3 SASI_Hs02_00311394 predicted 616
4 SASI_Hs02_00311395 predicted 649
5 SASI_Hs02_00311396 predicted 717
6 SASI_Hs02_00311397 predicted 726
7 SASI_Hs02_00311398 predicted 648
8 SASI_Hs02_00311399 predicted 664
9 SASI_Hs02_00311400 predicted 683
10 SASI_Hs02_00311401 predicted 640
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002456 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333868 predicted 864
2 SASI_Hs02_00333869 predicted 865
3 SASI_Hs01_00105719 predicted 864
4 SASI_Hs02_00333870 predicted 890
5 SASI_Hs02_00333871 predicted 958
6 SASI_Hs02_00333872 predicted 960
7 SASI_Hs02_00333873 predicted 891
8 SASI_Hs02_00333874 predicted 907
9 SASI_Hs02_00333875 predicted 928
10 SASI_Hs02_00333876 predicted 888
11 SASI_Hs01_00105714 predicted 513
12 SASI_Hs01_00105715 predicted 666
13 SASI_Hs01_00105716 predicted 726
14 SASI_Hs01_00105717 predicted 676
15 SASI_Hs01_00105718 predicted 518
16 SASI_Hs01_00105720 predicted 812
17 SASI_Hs01_00105721 predicted 722
18 SASI_Hs01_00105722 predicted 497
19 SASI_Hs01_00105723 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012602 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259763 predicted 1852
2 SASI_Rn02_00259764 predicted 1636
3 SASI_Rn02_00259765 predicted 1479
4 SASI_Rn02_00259766 predicted 1029
5 SASI_Rn02_00259767 predicted 1941
6 SASI_Rn02_00259768 predicted 1289
7 SASI_Rn02_00259769 predicted 968
8 SASI_Rn02_00259770 predicted 1455
9 SASI_Rn02_00259771 predicted 616
10 SASI_Rn02_00259772 predicted 918
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013605 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130611 predicted 1423
2 SASI_Mm01_00130612 predicted 791
3 SASI_Mm01_00130613 predicted 1800
4 SASI_Mm01_00130614 predicted 1498
5 SASI_Mm01_00130615 predicted 1248
6 SASI_Mm01_00130616 predicted 1705
7 SASI_Mm01_00130617 predicted 1234
8 SASI_Mm01_00130618 predicted 1716
9 SASI_Mm01_00130619 predicted 1121
10 SASI_Mm01_00130620 predicted 968
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002456
VALIDATED
MUC1 MISSION shRNA Bacterial Glycerol Stock
mucin 1, cell surface associated
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122934    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002456.4-1030s1c1
Sequence:CCGGCCACCAATTTCTCGGACACTTCTCGAGAAGTGTCCGAGAAATTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002456.4-507s1c1
Sequence:CCGGCTCTCGATATAACCTGACGATCTCGAGATCGTCAGGTTATATCGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002456.4-474s1c1
Sequence:CCGGGACACAGTTCAATCAGTATAACTCGAGTTATACTGATTGAACTGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002456.4-276s1c1
Sequence:CCGGCCAGTTTAATTCCTCTCTGGACTCGAGTCCAGAGAGGAATTAAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002456.4-717s1c1
Sequence:CCGGCCGGGATACCTACCATCCTATCTCGAGATAGGATGGTAGGTATCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002456.4-111s21c1
Sequence:CCGGCACAGTGCTTACAGTTGTTACCTCGAGGTAACAACTGTAAGCACTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002456.4-408s21c1
Sequence:CCGGAGGATCTGTGGTGGTACAATTCTCGAGAATTGTACCACCACAGATCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002456
VALIDATED
MUC1 MISSION shRNA shRNA Plasmid DNA
mucin 1, cell surface associated
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122934    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002456.4-1030s1c1
Sequence:CCGGCCACCAATTTCTCGGACACTTCTCGAGAAGTGTCCGAGAAATTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002456.4-507s1c1
Sequence:CCGGCTCTCGATATAACCTGACGATCTCGAGATCGTCAGGTTATATCGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002456.4-474s1c1
Sequence:CCGGGACACAGTTCAATCAGTATAACTCGAGTTATACTGATTGAACTGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002456.4-276s1c1
Sequence:CCGGCCAGTTTAATTCCTCTCTGGACTCGAGTCCAGAGAGGAATTAAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002456.4-717s1c1
Sequence:CCGGCCGGGATACCTACCATCCTATCTCGAGATAGGATGGTAGGTATCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002456.4-111s21c1
Sequence:CCGGCACAGTGCTTACAGTTGTTACCTCGAGGTAACAACTGTAAGCACTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002456.4-408s21c1
Sequence:CCGGAGGATCTGTGGTGGTACAATTCTCGAGAATTGTACCACCACAGATCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002456
VALIDATED
MUC1 MISSION shRNA Lentiviral Transduction Particles
mucin 1, cell surface associated
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122934    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002456.4-1030s1c1
Sequence:CCGGCCACCAATTTCTCGGACACTTCTCGAGAAGTGTCCGAGAAATTGGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002456.4-507s1c1
Sequence:CCGGCTCTCGATATAACCTGACGATCTCGAGATCGTCAGGTTATATCGAGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002456.4-474s1c1
Sequence:CCGGGACACAGTTCAATCAGTATAACTCGAGTTATACTGATTGAACTGTGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002456.4-276s1c1
Sequence:CCGGCCAGTTTAATTCCTCTCTGGACTCGAGTCCAGAGAGGAATTAAACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002456.4-717s1c1
Sequence:CCGGCCGGGATACCTACCATCCTATCTCGAGATAGGATGGTAGGTATCCCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002456.4-111s21c1
Sequence:CCGGCACAGTGCTTACAGTTGTTACCTCGAGGTAACAACTGTAAGCACTGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002456.4-408s21c1
Sequence:CCGGAGGATCTGTGGTGGTACAATTCTCGAGAATTGTACCACCACAGATCCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013605
MUC1 MISSION shRNA Bacterial Glycerol Stock
mucin 1, cell surface associated
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108855    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013605.1-2074s1c1
Sequence:CCGGGCTGTTCATGCCCTTTGTCAACTCGAGTTGACAAAGGGCATGAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013605.1-181s1c1
Sequence:CCGGGCAGTTCCTTAGCATCGACTACTCGAGTAGTCGATGCTAAGGAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013605.1-104s1c1
Sequence:CCGGGCTACTTCTAGCAAGTCTAAACTCGAGTTTAGACTTGCTAGAAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013605.1-1906s1c1
Sequence:CCGGGCAGTAGCAGTCTCTCTTATACTCGAGTATAAGAGAGACTGCTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013605.1-1116s1c1
Sequence:CCGGGCTACCAGTCTAGTCTATAATCTCGAGATTATAGACTAGACTGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013605.1-1045s21c1
Sequence:CCGGCGTCAGGCTCAGCTATCATTCCTCGAGGAATGATAGCTGAGCCTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013605.1-1545s21c1
Sequence:CCGGGACGTGAAGTCACAGCTTATACTCGAGTATAAGCTGTGACTTCACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013605.1-1257s21c1
Sequence:CCGGTACTATAGCACAGTACCATTTCTCGAGAAATGGTACTGTGCTATAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013605
MUC1 MISSION shRNA shRNA Plasmid DNA
mucin 1, cell surface associated
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108855    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013605.1-2074s1c1
Sequence:CCGGGCTGTTCATGCCCTTTGTCAACTCGAGTTGACAAAGGGCATGAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013605.1-181s1c1
Sequence:CCGGGCAGTTCCTTAGCATCGACTACTCGAGTAGTCGATGCTAAGGAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013605.1-104s1c1
Sequence:CCGGGCTACTTCTAGCAAGTCTAAACTCGAGTTTAGACTTGCTAGAAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013605.1-1906s1c1
Sequence:CCGGGCAGTAGCAGTCTCTCTTATACTCGAGTATAAGAGAGACTGCTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013605.1-1116s1c1
Sequence:CCGGGCTACCAGTCTAGTCTATAATCTCGAGATTATAGACTAGACTGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013605.1-1045s21c1
Sequence:CCGGCGTCAGGCTCAGCTATCATTCCTCGAGGAATGATAGCTGAGCCTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013605.1-1545s21c1
Sequence:CCGGGACGTGAAGTCACAGCTTATACTCGAGTATAAGCTGTGACTTCACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013605.1-1257s21c1
Sequence:CCGGTACTATAGCACAGTACCATTTCTCGAGAAATGGTACTGTGCTATAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013605
MUC1 MISSION shRNA Lentiviral Transduction Particles
mucin 1, cell surface associated
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108855    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013605.1-2074s1c1
Sequence:CCGGGCTGTTCATGCCCTTTGTCAACTCGAGTTGACAAAGGGCATGAACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013605.1-181s1c1
Sequence:CCGGGCAGTTCCTTAGCATCGACTACTCGAGTAGTCGATGCTAAGGAACTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013605.1-104s1c1
Sequence:CCGGGCTACTTCTAGCAAGTCTAAACTCGAGTTTAGACTTGCTAGAAGTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013605.1-1906s1c1
Sequence:CCGGGCAGTAGCAGTCTCTCTTATACTCGAGTATAAGAGAGACTGCTACTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013605.1-1116s1c1
Sequence:CCGGGCTACCAGTCTAGTCTATAATCTCGAGATTATAGACTAGACTGGTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013605.1-1045s21c1
Sequence:CCGGCGTCAGGCTCAGCTATCATTCCTCGAGGAATGATAGCTGAGCCTGACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013605.1-1545s21c1
Sequence:CCGGGACGTGAAGTCACAGCTTATACTCGAGTATAAGCTGTGACTTCACGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013605.1-1257s21c1
Sequence:CCGGTACTATAGCACAGTACCATTTCTCGAGAAATGGTACTGTGCTATAGTATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)