EMAIL THIS PAGE TO A FRIEND

MUC20

mucin 20, cell surface associated

83 Gene Product Result for
Synonyms: MUC-20
Gene ID:
Human(200958) Summary: This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins secreted by many epithelial tissues to form an insoluble mucous barrier. The shorter isoform expressed by this gene is localized to the plasma membrane, whereas the longer isoform might be secreted. The C terminus of this protein associates with the multifunctional docking site of the met proto-oncogene and suppresses activation of some downstream met signaling cascades. The protein features a tandem repeat domain that varies between 2 and 6 copies in most individuals. The allele represented in the human reference assembly contains 12 copies. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Mouse(224116) mucin 20
Rat(303886) mucin 20, cell surface associated
dog(488023) mucin 20, cell surface associated
cow(504643) mucin 20, cell surface associated
domestic cat(101080820) mucin 20, cell surface associated
domestic guinea pig(101787095) mucin 20, cell surface associated
naked mole-rat(101700440) mucin 20, cell surface associated
sheep(101122406) mucin 20, cell surface associated
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146071 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146071 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146071 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152673 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152673 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152673 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120311 MISSION® esiRNA esiRNA human MUC20 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098516 Rosetta Predictions human pricing
NM_152673 Rosetta Predictions human pricing
NM_001107089 Rosetta Predictions rat pricing
NM_146071 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098516 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319217 predicted 1247
2 SASI_Hs02_00319218 predicted 1108
3 SASI_Hs02_00319219 predicted 1083
4 SASI_Hs02_00319220 predicted 2081
5 SASI_Hs02_00319221 predicted 1809
6 SASI_Hs02_00319222 predicted 2093
7 SASI_Hs02_00319223 predicted 1104
8 SASI_Hs02_00319224 predicted 1473
9 SASI_Hs02_00319225 predicted 2249
10 SASI_Hs02_00319226 predicted 1408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152673 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366562 predicted 992
2 SASI_Hs01_00215059 predicted 856
3 SASI_Hs02_00366563 predicted 831
4 SASI_Hs01_00215061 predicted 1829
5 SASI_Hs01_00215062 predicted 1566
6 SASI_Hs01_00215065 predicted 1849
7 SASI_Hs02_00366564 predicted 858
8 SASI_Hs02_00366565 predicted 2011
9 SASI_Hs01_00215066 predicted 1220
10 SASI_Hs02_00366566 predicted 1155
11 SASI_Hs01_00215057 predicted 471
12 SASI_Hs01_00215058 predicted 983
13 SASI_Hs01_00215060 predicted 496
14 SASI_Hs01_00215063 predicted 333
15 SASI_Hs01_00215064 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107089 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225386 predicted 643
2 SASI_Rn02_00225387 predicted 223
3 SASI_Rn02_00225388 predicted 914
4 SASI_Rn02_00225389 predicted 640
5 SASI_Rn02_00225390 predicted 497
6 SASI_Rn02_00225391 predicted 740
7 SASI_Rn02_00225392 predicted 484
8 SASI_Rn02_00225393 predicted 1224
9 SASI_Rn02_00225394 predicted 1270
10 SASI_Rn02_00225395 predicted 556
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146071 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160468 predicted 1620
2 SASI_Mm01_00160469 predicted 734
3 SASI_Mm01_00160470 predicted 1409
4 SASI_Mm01_00160471 predicted 780
5 SASI_Mm01_00160472 predicted 952
6 SASI_Mm01_00160473 predicted 1447
7 SASI_Mm01_00160475 predicted 1719
8 SASI_Mm01_00160476 predicted 389
9 SASI_Mm01_00160477 predicted 250
10 SASI_Mm02_00341691 predicted 1871
11 SASI_Mm01_00160474 predicted 944
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146071
MUC20 MISSION shRNA Bacterial Glycerol Stock
mucin 20, cell surface associated
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146071.1-238s1c1
Sequence:CCGGCAGCACTGAATCTGCTTCTAACTCGAGTTAGAAGCAGATTCAGTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146071.1-771s1c1
Sequence:CCGGCGGTTTCAATAAGAATACCTTCTCGAGAAGGTATTCTTATTGAAACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194027    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146071.1-2085s1c1
Sequence:CCGGGCTATGGACTCCAAAGTTTCTCTCGAGAGAAACTTTGGAGTCCATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146071.1-402s1c1
Sequence:CCGGCAACCCTGAATATTCAGATTACTCGAGTAATCTGAATATTCAGGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146071.2-918s21c1
Sequence:CCGGACTCCATAGAAGCCGTCTTTGCTCGAGCAAAGACGGCTTCTATGGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146071.2-742s21c1
Sequence:CCGGACCTATTGAATTGACCCTAAACTCGAGTTTAGGGTCAATTCAATAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420759    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146071.2-2176s21c1
Sequence:CCGGACAAGACCTTGGTCCACTTATCTCGAGATAAGTGGACCAAGGTCTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146071.2-1135s21c1
Sequence:CCGGCTTCAACATCACTCATATTAACTCGAGTTAATATGAGTGATGTTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146071.2-111s21c1
Sequence:CCGGGCTCTCCAGGTCTCGACATTACTCGAGTAATGTCGAGACCTGGAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146071
MUC20 MISSION shRNA shRNA Plasmid DNA
mucin 20, cell surface associated
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146071.1-238s1c1
Sequence:CCGGCAGCACTGAATCTGCTTCTAACTCGAGTTAGAAGCAGATTCAGTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146071.1-771s1c1
Sequence:CCGGCGGTTTCAATAAGAATACCTTCTCGAGAAGGTATTCTTATTGAAACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194027    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146071.1-2085s1c1
Sequence:CCGGGCTATGGACTCCAAAGTTTCTCTCGAGAGAAACTTTGGAGTCCATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146071.1-402s1c1
Sequence:CCGGCAACCCTGAATATTCAGATTACTCGAGTAATCTGAATATTCAGGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146071.2-918s21c1
Sequence:CCGGACTCCATAGAAGCCGTCTTTGCTCGAGCAAAGACGGCTTCTATGGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146071.2-742s21c1
Sequence:CCGGACCTATTGAATTGACCCTAAACTCGAGTTTAGGGTCAATTCAATAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420759    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146071.2-2176s21c1
Sequence:CCGGACAAGACCTTGGTCCACTTATCTCGAGATAAGTGGACCAAGGTCTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146071.2-1135s21c1
Sequence:CCGGCTTCAACATCACTCATATTAACTCGAGTTAATATGAGTGATGTTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146071.2-111s21c1
Sequence:CCGGGCTCTCCAGGTCTCGACATTACTCGAGTAATGTCGAGACCTGGAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146071
MUC20 MISSION shRNA Lentiviral Transduction Particles
mucin 20, cell surface associated
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146071.1-238s1c1
Sequence:CCGGCAGCACTGAATCTGCTTCTAACTCGAGTTAGAAGCAGATTCAGTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146071.1-771s1c1
Sequence:CCGGCGGTTTCAATAAGAATACCTTCTCGAGAAGGTATTCTTATTGAAACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194027    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146071.1-2085s1c1
Sequence:CCGGGCTATGGACTCCAAAGTTTCTCTCGAGAGAAACTTTGGAGTCCATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146071.1-402s1c1
Sequence:CCGGCAACCCTGAATATTCAGATTACTCGAGTAATCTGAATATTCAGGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146071.2-918s21c1
Sequence:CCGGACTCCATAGAAGCCGTCTTTGCTCGAGCAAAGACGGCTTCTATGGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146071.2-742s21c1
Sequence:CCGGACCTATTGAATTGACCCTAAACTCGAGTTTAGGGTCAATTCAATAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420759    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146071.2-2176s21c1
Sequence:CCGGACAAGACCTTGGTCCACTTATCTCGAGATAAGTGGACCAAGGTCTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146071.2-1135s21c1
Sequence:CCGGCTTCAACATCACTCATATTAACTCGAGTTAATATGAGTGATGTTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146071.2-111s21c1
Sequence:CCGGGCTCTCCAGGTCTCGACATTACTCGAGTAATGTCGAGACCTGGAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152673
MUC20 MISSION shRNA Bacterial Glycerol Stock
mucin 20, cell surface associated
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152673.1-1242s1c1
Sequence:CCGGCAAGATCACAACCTCAGCGAACTCGAGTTCGCTGAGGTTGTGATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152673.1-765s1c1
Sequence:CCGGCACAAACATCGAGGTTATTAACTCGAGTTAATAACCTCGATGTTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152673.1-791s1c1
Sequence:CCGGGCATCACAGAAATAGAAACAACTCGAGTTGTTTCTATTTCTGTGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152673.1-495s1c1
Sequence:CCGGCACAATGGACATATTGACATTCTCGAGAATGTCAATATGTCCATTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152673.1-788s1c1
Sequence:CCGGGCAGCATCACAGAAATAGAAACTCGAGTTTCTATTTCTGTGATGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163433    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152673.1-979s1c1
Sequence:CCGGGAGACACCAAGTTACGTCAAACTCGAGTTTGACGTAACTTGGTGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152673.1-1235s1c1
Sequence:CCGGCCTTAGCCAAGATCACAACCTCTCGAGAGGTTGTGATCTTGGCTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152673.1-439s1c1
Sequence:CCGGGAAGCCATCTTTGACACCCTTCTCGAGAAGGGTGTCAAAGATGGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152673.1-985s1c1
Sequence:CCGGCCAAGTTACGTCAAAGTCTCACTCGAGTGAGACTTTGACGTAACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152673.1-981s1c1
Sequence:CCGGGACACCAAGTTACGTCAAAGTCTCGAGACTTTGACGTAACTTGGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152673
MUC20 MISSION shRNA shRNA Plasmid DNA
mucin 20, cell surface associated
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152673.1-1242s1c1
Sequence:CCGGCAAGATCACAACCTCAGCGAACTCGAGTTCGCTGAGGTTGTGATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152673.1-765s1c1
Sequence:CCGGCACAAACATCGAGGTTATTAACTCGAGTTAATAACCTCGATGTTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152673.1-791s1c1
Sequence:CCGGGCATCACAGAAATAGAAACAACTCGAGTTGTTTCTATTTCTGTGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152673.1-495s1c1
Sequence:CCGGCACAATGGACATATTGACATTCTCGAGAATGTCAATATGTCCATTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152673.1-788s1c1
Sequence:CCGGGCAGCATCACAGAAATAGAAACTCGAGTTTCTATTTCTGTGATGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163433    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152673.1-979s1c1
Sequence:CCGGGAGACACCAAGTTACGTCAAACTCGAGTTTGACGTAACTTGGTGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152673.1-1235s1c1
Sequence:CCGGCCTTAGCCAAGATCACAACCTCTCGAGAGGTTGTGATCTTGGCTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152673.1-439s1c1
Sequence:CCGGGAAGCCATCTTTGACACCCTTCTCGAGAAGGGTGTCAAAGATGGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152673.1-985s1c1
Sequence:CCGGCCAAGTTACGTCAAAGTCTCACTCGAGTGAGACTTTGACGTAACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152673.1-981s1c1
Sequence:CCGGGACACCAAGTTACGTCAAAGTCTCGAGACTTTGACGTAACTTGGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152673
MUC20 MISSION shRNA Lentiviral Transduction Particles
mucin 20, cell surface associated
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152673.1-1242s1c1
Sequence:CCGGCAAGATCACAACCTCAGCGAACTCGAGTTCGCTGAGGTTGTGATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152673.1-765s1c1
Sequence:CCGGCACAAACATCGAGGTTATTAACTCGAGTTAATAACCTCGATGTTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152673.1-791s1c1
Sequence:CCGGGCATCACAGAAATAGAAACAACTCGAGTTGTTTCTATTTCTGTGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152673.1-495s1c1
Sequence:CCGGCACAATGGACATATTGACATTCTCGAGAATGTCAATATGTCCATTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152673.1-788s1c1
Sequence:CCGGGCAGCATCACAGAAATAGAAACTCGAGTTTCTATTTCTGTGATGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163433    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152673.1-979s1c1
Sequence:CCGGGAGACACCAAGTTACGTCAAACTCGAGTTTGACGTAACTTGGTGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152673.1-1235s1c1
Sequence:CCGGCCTTAGCCAAGATCACAACCTCTCGAGAGGTTGTGATCTTGGCTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152673.1-439s1c1
Sequence:CCGGGAAGCCATCTTTGACACCCTTCTCGAGAAGGGTGTCAAAGATGGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152673.1-985s1c1
Sequence:CCGGCCAAGTTACGTCAAAGTCTCACTCGAGTGAGACTTTGACGTAACTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152673.1-981s1c1
Sequence:CCGGGACACCAAGTTACGTCAAAGTCTCGAGACTTTGACGTAACTTGGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)