EMAIL THIS PAGE TO A FRIEND

MUC21

mucin 21, cell surface associated

74 Gene Product Result for
Synonyms: C6orf205 KMQK697 MUC-21 bCX31G15.2
Species: Human MUC21(394263), Rat Muc21(502149), domestic guinea pig Muc21(101787518)
Gene ID:
Rat(502149) mucin 21, cell surface associated
domestic guinea pig(101787518) mucin 21, cell surface associated
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010909 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010909 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010909 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU118031 MISSION® esiRNA esiRNA human AL773541.6-201 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010909 Rosetta Predictions human pricing
XM_577604 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010909 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135323 predicted 304
2 SASI_Hs01_00135324 predicted 258
3 SASI_Hs01_00135326 predicted 1615
4 SASI_Hs01_00135327 predicted 1897
5 SASI_Hs01_00135328 predicted 1896
6 SASI_Hs01_00135329 predicted 259
7 SASI_Hs02_00305894 predicted 516
8 SASI_Hs01_00135330 predicted 1058
9 SASI_Hs01_00135325 predicted 263
10 SASI_Hs01_00135331 predicted 264
11 SASI_Hs01_00135332 predicted 1142
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577604 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00406819 predicted 727
2 SASI_Rn02_00406820 predicted 533
3 SASI_Rn02_00406821 predicted 631
4 SASI_Rn02_00406822 predicted 779
5 SASI_Rn02_00406823 predicted 1007
6 SASI_Rn02_00406824 predicted 220
7 SASI_Rn02_00406825 predicted 858
8 SASI_Rn02_00406826 predicted 263
9 SASI_Rn02_00406827 predicted 555
10 SASI_Rn02_00406828 predicted 1061
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010909
MUC21 MISSION shRNA Bacterial Glycerol Stock
mucin 21, cell surface associated
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010909.2-1093s21c1
Sequence:CCGGGGATCAGCACAGTCACCAATTCTCGAGAATTGGTGACTGTGCTGATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010909.2-1897s21c1
Sequence:CCGGGGAGACCAGTATCCTCGATAGCTCGAGCTATCGAGGATACTGGTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418929    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010909.2-1961s21c1
Sequence:CCGGGGAAGCAAGTGCCGCATTCTTCTCGAGAAGAATGCGGCACTTGCTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428150    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010909.2-2165s21c1
Sequence:CCGGATCTAACACACACGACAAAGACTCGAGTCTTTGTCGTGTGTGTTAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010909.1-1671s1c1
Sequence:CCGGCGTGGGAAATCTTCCTCATCACTCGAGTGATGAGGAAGATTTCCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010909.1-1602s1c1
Sequence:CCGGGAATGCACACAACTTCCCATACTCGAGTATGGGAAGTTGTGTGCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163012    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010909.1-2897s1c1
Sequence:CCGGGCAGAGAATTAGCAGTCTGTTCTCGAGAACAGACTGCTAATTCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161927    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010909.1-2039s1c1
Sequence:CCGGGCTTTGTTTGAGATCCTGAAACTCGAGTTTCAGGATCTCAAACAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010909.1-274s1c1
Sequence:CCGGGTTTGGTCTACTATTGCATTTCTCGAGAAATGCAATAGTAGACCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010909.1-300s1c1
Sequence:CCGGCTGCAACAAATTCCAATGAGACTCGAGTCTCATTGGAATTTGTTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010909.1-1143s1c1
Sequence:CCGGCCAACTCTGAGTCCAGTACAACTCGAGTTGTACTGGACTCAGAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010909
MUC21 MISSION shRNA shRNA Plasmid DNA
mucin 21, cell surface associated
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010909.2-1093s21c1
Sequence:CCGGGGATCAGCACAGTCACCAATTCTCGAGAATTGGTGACTGTGCTGATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010909.2-1897s21c1
Sequence:CCGGGGAGACCAGTATCCTCGATAGCTCGAGCTATCGAGGATACTGGTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418929    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010909.2-1961s21c1
Sequence:CCGGGGAAGCAAGTGCCGCATTCTTCTCGAGAAGAATGCGGCACTTGCTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428150    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010909.2-2165s21c1
Sequence:CCGGATCTAACACACACGACAAAGACTCGAGTCTTTGTCGTGTGTGTTAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010909.1-1671s1c1
Sequence:CCGGCGTGGGAAATCTTCCTCATCACTCGAGTGATGAGGAAGATTTCCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010909.1-1602s1c1
Sequence:CCGGGAATGCACACAACTTCCCATACTCGAGTATGGGAAGTTGTGTGCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163012    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010909.1-2897s1c1
Sequence:CCGGGCAGAGAATTAGCAGTCTGTTCTCGAGAACAGACTGCTAATTCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161927    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010909.1-2039s1c1
Sequence:CCGGGCTTTGTTTGAGATCCTGAAACTCGAGTTTCAGGATCTCAAACAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010909.1-274s1c1
Sequence:CCGGGTTTGGTCTACTATTGCATTTCTCGAGAAATGCAATAGTAGACCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010909.1-300s1c1
Sequence:CCGGCTGCAACAAATTCCAATGAGACTCGAGTCTCATTGGAATTTGTTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010909.1-1143s1c1
Sequence:CCGGCCAACTCTGAGTCCAGTACAACTCGAGTTGTACTGGACTCAGAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010909
MUC21 MISSION shRNA Lentiviral Transduction Particles
mucin 21, cell surface associated
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010909.2-1093s21c1
Sequence:CCGGGGATCAGCACAGTCACCAATTCTCGAGAATTGGTGACTGTGCTGATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010909.2-1897s21c1
Sequence:CCGGGGAGACCAGTATCCTCGATAGCTCGAGCTATCGAGGATACTGGTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418929    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010909.2-1961s21c1
Sequence:CCGGGGAAGCAAGTGCCGCATTCTTCTCGAGAAGAATGCGGCACTTGCTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428150    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010909.2-2165s21c1
Sequence:CCGGATCTAACACACACGACAAAGACTCGAGTCTTTGTCGTGTGTGTTAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010909.1-1671s1c1
Sequence:CCGGCGTGGGAAATCTTCCTCATCACTCGAGTGATGAGGAAGATTTCCCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010909.1-1602s1c1
Sequence:CCGGGAATGCACACAACTTCCCATACTCGAGTATGGGAAGTTGTGTGCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163012    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010909.1-2897s1c1
Sequence:CCGGGCAGAGAATTAGCAGTCTGTTCTCGAGAACAGACTGCTAATTCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161927    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010909.1-2039s1c1
Sequence:CCGGGCTTTGTTTGAGATCCTGAAACTCGAGTTTCAGGATCTCAAACAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010909.1-274s1c1
Sequence:CCGGGTTTGGTCTACTATTGCATTTCTCGAGAAATGCAATAGTAGACCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010909.1-300s1c1
Sequence:CCGGCTGCAACAAATTCCAATGAGACTCGAGTCTCATTGGAATTTGTTGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010909.1-1143s1c1
Sequence:CCGGCCAACTCTGAGTCCAGTACAACTCGAGTTGTACTGGACTCAGAGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)