EMAIL THIS PAGE TO A FRIEND

MUC2

mucin 2, oligomeric mucus/gel-forming

52 Gene Product Result for
Synonyms: MLP MUC-2 SMUC
UniProtKB ID: Q02817, Q14878
Gene ID:
Human(4583) Summary: This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Jul 2008]
Mouse(17831) mucin 2
Rat(24572) mucin 2, oligomeric mucus/gel-forming
sheep(780488) mucin 2, oligomeric mucus/gel-forming
domestic guinea pig(101788748) mucin 2, oligomeric mucus/gel-forming
Zebrafish(100332798) mucin 2, oligomeric mucus/gel-forming
chicken(423101) mucin 2, oligomeric mucus/gel-forming
dog(483653) mucin 2, oligomeric mucus/gel-forming
domestic cat(101096605) mucin 2, oligomeric mucus/gel-forming
Horse(100072190) mucin 2, oligomeric mucus/gel-forming
cow(789571) mucin 2
Horse(100629257) mucin 2, oligomeric mucus/gel-forming
Horse(100056112) mucin 2, oligomeric mucus/gel-forming
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002457 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002457 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002457 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU210481 MISSION® esiRNA esiRNA targeting mouse ENSMUSG00000025515 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002457 Rosetta Predictions human pricing
XM_001001905 Rosetta Predictions mouse pricing
XM_975612 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002457 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117968 predicted 14663
2 SASI_Hs02_00333877 predicted 1118
3 SASI_Hs01_00117970 predicted 2607
4 SASI_Hs01_00117971 predicted 2628
5 SASI_Hs01_00117972 predicted 1862
6 SASI_Hs01_00117973 predicted 3532
7 SASI_Hs01_00117974 predicted 13120
8 SASI_Hs01_00117975 predicted 1846
9 SASI_Hs01_00117976 predicted 15053
10 SASI_Hs02_00333878 predicted 2653
11 SASI_Hs01_00117969 predicted 15150
12 SASI_Hs01_00117977 predicted 13313
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001001905 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00355320 predicted 2670
2 SASI_Mm02_00355321 predicted 6404
3 SASI_Mm02_00355322 predicted 2263
4 SASI_Mm02_00355323 predicted 1845
5 SASI_Mm02_00355324 predicted 2964
6 SASI_Mm02_00355325 predicted 3603
7 SASI_Mm02_00355326 predicted 1681
8 SASI_Mm02_00355327 predicted 4649
9 SASI_Mm02_00355328 predicted 5165
10 SASI_Mm02_00355329 predicted 5349
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_975612 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00262218 predicted 1538
2 SASI_Mm01_00262219 predicted 1059
3 SASI_Mm01_00262220 predicted 1266
4 SASI_Mm01_00262221 predicted 1962
5 SASI_Mm01_00262222 predicted 1444
6 SASI_Mm01_00262223 predicted 1645
7 SASI_Mm01_00262224 predicted 1616
8 SASI_Mm01_00262226 predicted 821
9 SASI_Mm01_00262227 predicted 2170
10 SASI_Mm02_00445717 predicted 1759
11 SASI_Mm01_00262225 predicted 2993
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002457
MUC2 MISSION shRNA Bacterial Glycerol Stock
mucin 2, oligomeric mucus/gel-forming
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002457.1-13581s1c1
Sequence:CCGGCGGAGTTTACATCGACAACTACTCGAGTAGTTGTCGATGTAAACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002457.1-229s1c1
Sequence:CCGGCGAGGCTCCTACAAGGAATTTCTCGAGAAATTCCTTGTAGGAGCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002457.1-4167s1c1
Sequence:CCGGCGACTACAAGATACGTGTCAACTCGAGTTGACACGTATCTTGTAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002457.1-5144s1c1
Sequence:CCGGGCTCTCCAATAACCACCACAACTCGAGTTGTGGTGGTTATTGGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002457.1-2493s1c1
Sequence:CCGGCGTCCATAACAACGACCTGTACTCGAGTACAGGTCGTTGTTATGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002457
MUC2 MISSION shRNA shRNA Plasmid DNA
mucin 2, oligomeric mucus/gel-forming
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002457.1-13581s1c1
Sequence:CCGGCGGAGTTTACATCGACAACTACTCGAGTAGTTGTCGATGTAAACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002457.1-229s1c1
Sequence:CCGGCGAGGCTCCTACAAGGAATTTCTCGAGAAATTCCTTGTAGGAGCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002457.1-4167s1c1
Sequence:CCGGCGACTACAAGATACGTGTCAACTCGAGTTGACACGTATCTTGTAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002457.1-5144s1c1
Sequence:CCGGGCTCTCCAATAACCACCACAACTCGAGTTGTGGTGGTTATTGGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002457.1-2493s1c1
Sequence:CCGGCGTCCATAACAACGACCTGTACTCGAGTACAGGTCGTTGTTATGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002457
MUC2 MISSION shRNA Lentiviral Transduction Particles
mucin 2, oligomeric mucus/gel-forming
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002457.1-13581s1c1
Sequence:CCGGCGGAGTTTACATCGACAACTACTCGAGTAGTTGTCGATGTAAACTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002457.1-229s1c1
Sequence:CCGGCGAGGCTCCTACAAGGAATTTCTCGAGAAATTCCTTGTAGGAGCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002457.1-4167s1c1
Sequence:CCGGCGACTACAAGATACGTGTCAACTCGAGTTGACACGTATCTTGTAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002457.1-5144s1c1
Sequence:CCGGGCTCTCCAATAACCACCACAACTCGAGTTGTGGTGGTTATTGGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002457.1-2493s1c1
Sequence:CCGGCGTCCATAACAACGACCTGTACTCGAGTACAGGTCGTTGTTATGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)