EMAIL THIS PAGE TO A FRIEND

MUC3

33 Gene Product Result for
Gene ID:
Mouse(666339) mucin 3, intestinal
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_355711 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_355711 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_355711 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU215531 MISSION® esiRNA esiRNA targeting mouse ENSMUSG00000037390 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001719766 Rosetta Predictions human pricing
XM_001478962 Rosetta Predictions mouse pricing
XM_355711 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001719766 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00432453 predicted 1241
2 SASI_Hs02_00432454 predicted 530
3 SASI_Hs02_00432455 predicted 1279
4 SASI_Hs02_00432456 predicted 686
5 SASI_Hs02_00432457 predicted 1646
6 SASI_Hs02_00432458 predicted 1339
7 SASI_Hs02_00432459 predicted 341
8 SASI_Hs02_00432460 predicted 767
9 SASI_Hs02_00432461 predicted 449
10 SASI_Hs02_00432462 predicted 631
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001478962 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00406629 predicted 8221
2 SASI_Mm02_00406630 predicted 7542
3 SASI_Mm02_00406631 predicted 7593
4 SASI_Mm02_00406632 predicted 1318
5 SASI_Mm02_00406633 predicted 1022
6 SASI_Mm02_00406634 predicted 8235
7 SASI_Mm02_00406635 predicted 7021
8 SASI_Mm02_00406636 predicted 3092
9 SASI_Mm02_00406637 predicted 291
10 SASI_Mm02_00406638 predicted 2677
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355711 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00281294 predicted 1448
2 SASI_Mm01_00281295 predicted 1304
3 SASI_Mm02_00425844 predicted 683
4 SASI_Mm01_00281296 predicted 1317
5 SASI_Mm01_00281298 predicted 1418
6 SASI_Mm01_00281300 predicted 833
7 SASI_Mm01_00281301 predicted 1316
8 SASI_Mm01_00281302 predicted 1443
9 SASI_Mm01_00281303 predicted 1301
10 SASI_Mm02_00425845 predicted 704
11 SASI_Mm01_00281297 predicted 3736
12 SASI_Mm01_00281299 predicted 4455
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_355711
MUC3 MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355711.1-382s1c1
Sequence:CCGGGCTCTGATTTATGCTGGCATACTCGAGTATGCCAGCATAAATCAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355711.1-30s1c1
Sequence:CCGGTGTGTACCAAATCTCTGCTTTCTCGAGAAAGCAGAGATTTGGTACACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355711.1-300s1c1
Sequence:CCGGCAGTCAAGAATACAGTGAGAACTCGAGTTCTCACTGTATTCTTGACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355711.1-63s1c1
Sequence:CCGGGAATTGTATGAACGGAGGGTTCTCGAGAACCCTCCGTTCATACAATTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355711.1-450s1c1
Sequence:CCGGCGTGGTGGATTATGATGTCATCTCGAGATGACATCATAATCCACCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_355711
MUC3 MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355711.1-382s1c1
Sequence:CCGGGCTCTGATTTATGCTGGCATACTCGAGTATGCCAGCATAAATCAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355711.1-30s1c1
Sequence:CCGGTGTGTACCAAATCTCTGCTTTCTCGAGAAAGCAGAGATTTGGTACACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355711.1-300s1c1
Sequence:CCGGCAGTCAAGAATACAGTGAGAACTCGAGTTCTCACTGTATTCTTGACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355711.1-63s1c1
Sequence:CCGGGAATTGTATGAACGGAGGGTTCTCGAGAACCCTCCGTTCATACAATTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355711.1-450s1c1
Sequence:CCGGCGTGGTGGATTATGATGTCATCTCGAGATGACATCATAATCCACCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_355711
MUC3 MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355711.1-382s1c1
Sequence:CCGGGCTCTGATTTATGCTGGCATACTCGAGTATGCCAGCATAAATCAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355711.1-30s1c1
Sequence:CCGGTGTGTACCAAATCTCTGCTTTCTCGAGAAAGCAGAGATTTGGTACACATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355711.1-300s1c1
Sequence:CCGGCAGTCAAGAATACAGTGAGAACTCGAGTTCTCACTGTATTCTTGACTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355711.1-63s1c1
Sequence:CCGGGAATTGTATGAACGGAGGGTTCTCGAGAACCCTCCGTTCATACAATTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355711.1-450s1c1
Sequence:CCGGCGTGGTGGATTATGATGTCATCTCGAGATGACATCATAATCCACCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)