EMAIL THIS PAGE TO A FRIEND

MUC4

mucin 4, cell surface associated

106 Gene Product Result for
Synonyms: ASGP HSA276359 MUC-4
Gene ID:
Human(4585) Summary: The major constituents of mucus, the viscous secretion that covers epithelial surfaces such as those in the trachea, colon, and cervix, are highly glycosylated proteins called mucins. These glycoproteins play important roles in the protection of the epithelial cells and have been implicated in epithelial renewal and differentiation. This gene encodes an integral membrane glycoprotein found on the cell surface, although secreted isoforms may exist. At least two dozen transcript variants of this gene have been found, although for many of them the full-length transcript has not been determined or they are found only in tumor tissues. This gene contains a region in the coding sequence which has a variable number (>100) of 48 nt tandem repeats. [provided by RefSeq, Jul 2008]
Mouse(140474) mucin 4
Rat(303887) mucin 4, cell surface associated
chicken(429149) mucin 4, cell surface associated
dog(488024) mucin 4, cell surface associated
domestic cat(101081074) mucin 4, cell surface associated
cow(786701) mucin 4, cell surface associated
Horse(100070060) mucin 4, cell surface associated
chicken(101664924) mucin 4, cell surface associated
chicken(101752124) mucin 4, cell surface associated
sheep(101122659) mucin 4, cell surface associated
naked mole-rat(101700798) mucin 4, cell surface associated
domestic guinea pig(100724323) mucin 4, cell surface associated
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004532 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004532 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004532 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080457 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080457 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080457 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004532 Rosetta Predictions human pricing
NM_018406 Rosetta Predictions human pricing
NM_138297 Rosetta Predictions human pricing
XM_001072593 Rosetta Predictions rat pricing
XM_221384 Rosetta Predictions rat pricing
NM_080457 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004532 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337831 predicted 3849
2 SASI_Hs01_00093210 predicted 3248
3 SASI_Hs02_00337832 predicted 1345
4 SASI_Hs01_00093215 predicted 2613
5 SASI_Hs02_00337833 predicted 4026
6 SASI_Hs02_00337834 predicted 1093
7 SASI_Hs02_00337835 predicted 2537
8 SASI_Hs02_00337836 predicted 1094
9 SASI_Hs02_00337837 predicted 1333
10 SASI_Hs02_00337838 predicted 2613
11 SASI_Hs01_00093208 predicted 3119
12 SASI_Hs01_00093209 predicted 2767
13 SASI_Hs01_00093211 predicted 2486
14 SASI_Hs01_00093212 predicted 1827
15 SASI_Hs01_00093213 predicted 3909
16 SASI_Hs01_00093214 predicted 2633
17 SASI_Hs01_00093216 predicted 2994
18 SASI_Hs01_00093217 predicted 2864
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018406 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351906 predicted 16172
2 SASI_Hs01_00121893 predicted 15567
3 SASI_Hs02_00351907 predicted 13669
4 SASI_Hs01_00121898 predicted 14937
5 SASI_Hs02_00351908 predicted 16347
6 SASI_Hs02_00351909 predicted 13415
7 SASI_Hs02_00351910 predicted 14865
8 SASI_Hs02_00351911 predicted 13420
9 SASI_Hs02_00351912 predicted 13658
10 SASI_Hs02_00351913 predicted 14932
11 SASI_Hs01_00121891 predicted 6096
12 SASI_Hs01_00121892 predicted 5738
13 SASI_Hs01_00121894 predicted 5468
14 SASI_Hs01_00121895 predicted 4800
15 SASI_Hs01_00121896 predicted 6886
16 SASI_Hs01_00121897 predicted 5606
17 SASI_Hs01_00121899 predicted 5974
18 SASI_Hs01_00121900 predicted 5842
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138297 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363391 predicted 3701
2 SASI_Hs01_00194645 predicted 3099
3 SASI_Hs02_00363392 predicted 1190
4 SASI_Hs01_00194650 predicted 2458
5 SASI_Hs02_00363393 predicted 3875
6 SASI_Hs02_00363394 predicted 937
7 SASI_Hs02_00363395 predicted 2388
8 SASI_Hs02_00363396 predicted 940
9 SASI_Hs02_00363397 predicted 1180
10 SASI_Hs02_00363398 predicted 2455
11 SASI_Hs01_00194643 predicted 2963
12 SASI_Hs01_00194644 predicted 2612
13 SASI_Hs01_00194646 predicted 2340
14 SASI_Hs01_00194647 predicted 1672
15 SASI_Hs01_00194648 predicted 3764
16 SASI_Hs01_00194649 predicted 2479
17 SASI_Hs01_00194651 predicted 2846
18 SASI_Hs01_00194652 predicted 2712
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072593 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00339810 predicted 2139
2 SASI_Rn02_00339811 predicted 6735
3 SASI_Rn02_00339812 predicted 2184
4 SASI_Rn02_00339813 predicted 6484
5 SASI_Rn02_00339814 predicted 2889
6 SASI_Rn02_00339815 predicted 7265
7 SASI_Rn02_00339816 predicted 6756
8 SASI_Rn02_00339817 predicted 6767
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221384 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380074 predicted 511
2 SASI_Rn02_00380075 predicted 655
3 SASI_Rn02_00380076 predicted 2051
4 SASI_Rn02_00380077 predicted 1540
5 SASI_Rn02_00380078 predicted 585
6 SASI_Rn02_00380079 predicted 426
7 SASI_Rn02_00380080 predicted 279
8 SASI_Rn02_00380081 predicted 1462
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080457 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154709 predicted 6100
2 SASI_Mm01_00154710 predicted 1326
3 SASI_Mm01_00154711 predicted 9133
4 SASI_Mm02_00338118 predicted 7140
5 SASI_Mm01_00154712 predicted 1798
6 SASI_Mm01_00154714 predicted 9815
7 SASI_Mm01_00154715 predicted 2029
8 SASI_Mm02_00338119 predicted 8959
9 SASI_Mm02_00338120 predicted 2449
10 SASI_Mm02_00338121 predicted 9261
11 SASI_Mm01_00154713 predicted 4135
12 SASI_Mm01_00154716 predicted 6395
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004532
MUC4 MISSION shRNA Bacterial Glycerol Stock
mucin 4, cell surface associated
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004532.4-4128s21c1
Sequence:CCGGGGAATCAAGACAAGACTATACCTCGAGGTATAGTCTTGTCTTGATTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004532.2-1341s1c1
Sequence:CCGGCGCCCTGATAGATTCCTGAATCTCGAGATTCAGGAATCTATCAGGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004532.4-858s21c1
Sequence:CCGGCAGAGTCAGACTACCAGATTTCTCGAGAAATCTGGTAGTCTGACTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004532.2-3120s1c1
Sequence:CCGGCCTGTGAATTACTGCTACAATCTCGAGATTGTAGCAGTAATTCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004532.4-1276s21c1
Sequence:CCGGCTCTAGTGGAGATGGCTATTTCTCGAGAAATAGCCATCTCCACTAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004532.4-606s21c1
Sequence:CCGGCAACCTCCCAGACCATCATTTCTCGAGAAATGATGGTCTGGGAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004532.2-3119s1c1
Sequence:CCGGCCCTGTGAATTACTGCTACAACTCGAGTTGTAGCAGTAATTCACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123299    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004532.2-4028s1c1
Sequence:CCGGCCTCATCCTTACCGCACATTTCTCGAGAAATGTGCGGTAAGGATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004532.2-1342s1c1
Sequence:CCGGGCCCTGATAGATTCCTGAATTCTCGAGAATTCAGGAATCTATCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004532.4-2496s21c1
Sequence:CCGGGAGATAGCTCATGCATCTATGCTCGAGCATAGATGCATGAGCTATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004532
MUC4 MISSION shRNA shRNA Plasmid DNA
mucin 4, cell surface associated
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004532.4-4128s21c1
Sequence:CCGGGGAATCAAGACAAGACTATACCTCGAGGTATAGTCTTGTCTTGATTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004532.2-1341s1c1
Sequence:CCGGCGCCCTGATAGATTCCTGAATCTCGAGATTCAGGAATCTATCAGGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004532.4-858s21c1
Sequence:CCGGCAGAGTCAGACTACCAGATTTCTCGAGAAATCTGGTAGTCTGACTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004532.2-3120s1c1
Sequence:CCGGCCTGTGAATTACTGCTACAATCTCGAGATTGTAGCAGTAATTCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004532.4-1276s21c1
Sequence:CCGGCTCTAGTGGAGATGGCTATTTCTCGAGAAATAGCCATCTCCACTAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004532.4-606s21c1
Sequence:CCGGCAACCTCCCAGACCATCATTTCTCGAGAAATGATGGTCTGGGAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004532.2-3119s1c1
Sequence:CCGGCCCTGTGAATTACTGCTACAACTCGAGTTGTAGCAGTAATTCACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123299    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004532.2-4028s1c1
Sequence:CCGGCCTCATCCTTACCGCACATTTCTCGAGAAATGTGCGGTAAGGATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004532.2-1342s1c1
Sequence:CCGGGCCCTGATAGATTCCTGAATTCTCGAGAATTCAGGAATCTATCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004532.4-2496s21c1
Sequence:CCGGGAGATAGCTCATGCATCTATGCTCGAGCATAGATGCATGAGCTATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004532
MUC4 MISSION shRNA Lentiviral Transduction Particles
mucin 4, cell surface associated
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004532.4-4128s21c1
Sequence:CCGGGGAATCAAGACAAGACTATACCTCGAGGTATAGTCTTGTCTTGATTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004532.2-1341s1c1
Sequence:CCGGCGCCCTGATAGATTCCTGAATCTCGAGATTCAGGAATCTATCAGGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004532.4-858s21c1
Sequence:CCGGCAGAGTCAGACTACCAGATTTCTCGAGAAATCTGGTAGTCTGACTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004532.2-3120s1c1
Sequence:CCGGCCTGTGAATTACTGCTACAATCTCGAGATTGTAGCAGTAATTCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004532.4-1276s21c1
Sequence:CCGGCTCTAGTGGAGATGGCTATTTCTCGAGAAATAGCCATCTCCACTAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004532.4-606s21c1
Sequence:CCGGCAACCTCCCAGACCATCATTTCTCGAGAAATGATGGTCTGGGAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004532.2-3119s1c1
Sequence:CCGGCCCTGTGAATTACTGCTACAACTCGAGTTGTAGCAGTAATTCACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123299    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004532.2-4028s1c1
Sequence:CCGGCCTCATCCTTACCGCACATTTCTCGAGAAATGTGCGGTAAGGATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004532.2-1342s1c1
Sequence:CCGGGCCCTGATAGATTCCTGAATTCTCGAGAATTCAGGAATCTATCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004532.4-2496s21c1
Sequence:CCGGGAGATAGCTCATGCATCTATGCTCGAGCATAGATGCATGAGCTATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080457
MUC4 MISSION shRNA Bacterial Glycerol Stock
mucin 4, cell surface associated
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080457.1-5851s1c1
Sequence:CCGGGCCACCTCCTATGACCAAATTCTCGAGAATTTGGTCATAGGAGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119332    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080457.1-10497s1c1
Sequence:CCGGCCTGCTCTGTGGGACTGGAAACTCGAGTTTCCAGTCCCACAGAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080457.1-5107s1c1
Sequence:CCGGGCCACCTCACATGACCTAATTCTCGAGAATTAGGTCATGTGAGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080457.1-1403s1c1
Sequence:CCGGGCACGTCTACTCAGGAATTAACTCGAGTTAATTCCTGAGTAGACGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080457.1-150s1c1
Sequence:CCGGCCTGTATTCTTGCCTCCTCTTCTCGAGAAGAGGAGGCAAGAATACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080457
MUC4 MISSION shRNA shRNA Plasmid DNA
mucin 4, cell surface associated
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080457.1-5851s1c1
Sequence:CCGGGCCACCTCCTATGACCAAATTCTCGAGAATTTGGTCATAGGAGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119332    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080457.1-10497s1c1
Sequence:CCGGCCTGCTCTGTGGGACTGGAAACTCGAGTTTCCAGTCCCACAGAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080457.1-5107s1c1
Sequence:CCGGGCCACCTCACATGACCTAATTCTCGAGAATTAGGTCATGTGAGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080457.1-1403s1c1
Sequence:CCGGGCACGTCTACTCAGGAATTAACTCGAGTTAATTCCTGAGTAGACGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080457.1-150s1c1
Sequence:CCGGCCTGTATTCTTGCCTCCTCTTCTCGAGAAGAGGAGGCAAGAATACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080457
MUC4 MISSION shRNA Lentiviral Transduction Particles
mucin 4, cell surface associated
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080457.1-5851s1c1
Sequence:CCGGGCCACCTCCTATGACCAAATTCTCGAGAATTTGGTCATAGGAGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119332    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080457.1-10497s1c1
Sequence:CCGGCCTGCTCTGTGGGACTGGAAACTCGAGTTTCCAGTCCCACAGAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080457.1-5107s1c1
Sequence:CCGGGCCACCTCACATGACCTAATTCTCGAGAATTAGGTCATGTGAGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080457.1-1403s1c1
Sequence:CCGGGCACGTCTACTCAGGAATTAACTCGAGTTAATTCCTGAGTAGACGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080457.1-150s1c1
Sequence:CCGGCCTGTATTCTTGCCTCCTCTTCTCGAGAAGAGGAGGCAAGAATACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)