EMAIL THIS PAGE TO A FRIEND

MUC5AC

mucin 5AC, oligomeric mucus/gel-forming

74 Gene Product Result for
Synonyms: MUC5 TBM leB
Gene ID:
Mouse(17833) mucin 5, subtypes A and C, tracheobronchial/gastric
Rat(682837) mucin 5AC, oligomeric mucus/gel-forming
dog(483654) mucin 5AC, oligomeric mucus/gel-forming
cow(789503) mucin-5AC
Horse(100147340) mucin 5AC, oligomeric mucus/gel-forming
domestic guinea pig(101788031) mucin 5AC, oligomeric mucus/gel-forming
naked mole-rat(101720435) mucin 5AC, oligomeric mucus/gel-forming
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017511 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017511 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017511 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010844 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010844 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010844 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU192261 MISSION® esiRNA esiRNA targeting mouse Muc5ac mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017511 Rosetta Predictions human pricing
XM_001063331 Rosetta Predictions rat pricing
NM_010844 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017511 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350123 predicted 1294
2 SASI_Hs02_00350124 predicted 18716
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063331 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00306704 predicted 3365
2 SASI_Rn02_00306705 predicted 302
3 SASI_Rn02_00306706 predicted 2214
4 SASI_Rn02_00306707 predicted 597
5 SASI_Rn02_00306708 predicted 1584
6 SASI_Rn02_00306709 predicted 1849
7 SASI_Rn02_00306710 predicted 3694
8 SASI_Rn02_00306711 predicted 1362
9 SASI_Rn02_00306712 predicted 1418
10 SASI_Rn02_00306713 predicted 2277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010844 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319483 predicted 3326
2 SASI_Mm02_00319484 predicted 6423
3 SASI_Mm02_00319485 predicted 5777
4 SASI_Mm02_00319486 predicted 4493
5 SASI_Mm02_00319487 predicted 330
6 SASI_Mm02_00319488 predicted 6247
7 SASI_Mm02_00319489 predicted 1414
8 SASI_Mm02_00319490 predicted 7744
9 SASI_Mm02_00319491 predicted 6186
10 SASI_Mm02_00319492 predicted 2474
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017511
MUC5AC MISSION shRNA Bacterial Glycerol Stock
mucin 5AC, oligomeric mucus/gel-forming
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017511.1-6780s21c1
Sequence:CCGGGGACGTTGAGTCCTACGATAACTCGAGTTATCGTAGGACTCAACGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017511.1-16612s21c1
Sequence:CCGGCTGATCCTGTTTGACCAAATTCTCGAGAATTTGGTCAAACAGGATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017511.1-17816s21c1
Sequence:CCGGAGGAGGATGCCTGCAACAATACTCGAGTATTGTTGCAGGCATCCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017511.1-17387s21c1
Sequence:CCGGCCGATGGGTTTCCTAAATTTCCTCGAGGAAATTTAGGAAACCCATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017511.1-15634s21c1
Sequence:CCGGCTCACAGAGCCGAGCACTATACTCGAGTATAGTGCTCGGCTCTGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017511
MUC5AC MISSION shRNA shRNA Plasmid DNA
mucin 5AC, oligomeric mucus/gel-forming
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017511.1-6780s21c1
Sequence:CCGGGGACGTTGAGTCCTACGATAACTCGAGTTATCGTAGGACTCAACGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017511.1-16612s21c1
Sequence:CCGGCTGATCCTGTTTGACCAAATTCTCGAGAATTTGGTCAAACAGGATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017511.1-17816s21c1
Sequence:CCGGAGGAGGATGCCTGCAACAATACTCGAGTATTGTTGCAGGCATCCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017511.1-17387s21c1
Sequence:CCGGCCGATGGGTTTCCTAAATTTCCTCGAGGAAATTTAGGAAACCCATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017511.1-15634s21c1
Sequence:CCGGCTCACAGAGCCGAGCACTATACTCGAGTATAGTGCTCGGCTCTGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017511
MUC5AC MISSION shRNA Lentiviral Transduction Particles
mucin 5AC, oligomeric mucus/gel-forming
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017511.1-6780s21c1
Sequence:CCGGGGACGTTGAGTCCTACGATAACTCGAGTTATCGTAGGACTCAACGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017511.1-16612s21c1
Sequence:CCGGCTGATCCTGTTTGACCAAATTCTCGAGAATTTGGTCAAACAGGATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017511.1-17816s21c1
Sequence:CCGGAGGAGGATGCCTGCAACAATACTCGAGTATTGTTGCAGGCATCCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017511.1-17387s21c1
Sequence:CCGGCCGATGGGTTTCCTAAATTTCCTCGAGGAAATTTAGGAAACCCATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017511.1-15634s21c1
Sequence:CCGGCTCACAGAGCCGAGCACTATACTCGAGTATAGTGCTCGGCTCTGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010844
MUC5AC MISSION shRNA Bacterial Glycerol Stock
mucin 5AC, oligomeric mucus/gel-forming
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010844.1-8296s21c1
Sequence:CCGGAGGCCAGAAAGTGGCTTGAATCTCGAGATTCAAGCCACTTTCTGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010844.1-2400s21c1
Sequence:CCGGTGATGCACCCATGATCTATTTCTCGAGAAATAGATCATGGGTGCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010844.1-1632s21c1
Sequence:CCGGGATCCAGCTGAGTCCAATTATCTCGAGATAATTGGACTCAGCTGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010844.1-4075s21c1
Sequence:CCGGTCGACAACCAGCAGCATATTGCTCGAGCAATATGCTGCTGGTTGTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010844.1-365s21c1
Sequence:CCGGGCCGTGTCCAGGAGTCTAATACTCGAGTATTAGACTCCTGGACACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010844
MUC5AC MISSION shRNA shRNA Plasmid DNA
mucin 5AC, oligomeric mucus/gel-forming
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010844.1-8296s21c1
Sequence:CCGGAGGCCAGAAAGTGGCTTGAATCTCGAGATTCAAGCCACTTTCTGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010844.1-2400s21c1
Sequence:CCGGTGATGCACCCATGATCTATTTCTCGAGAAATAGATCATGGGTGCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010844.1-1632s21c1
Sequence:CCGGGATCCAGCTGAGTCCAATTATCTCGAGATAATTGGACTCAGCTGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010844.1-4075s21c1
Sequence:CCGGTCGACAACCAGCAGCATATTGCTCGAGCAATATGCTGCTGGTTGTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010844.1-365s21c1
Sequence:CCGGGCCGTGTCCAGGAGTCTAATACTCGAGTATTAGACTCCTGGACACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010844
MUC5AC MISSION shRNA Lentiviral Transduction Particles
mucin 5AC, oligomeric mucus/gel-forming
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010844.1-8296s21c1
Sequence:CCGGAGGCCAGAAAGTGGCTTGAATCTCGAGATTCAAGCCACTTTCTGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010844.1-2400s21c1
Sequence:CCGGTGATGCACCCATGATCTATTTCTCGAGAAATAGATCATGGGTGCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010844.1-1632s21c1
Sequence:CCGGGATCCAGCTGAGTCCAATTATCTCGAGATAATTGGACTCAGCTGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010844.1-4075s21c1
Sequence:CCGGTCGACAACCAGCAGCATATTGCTCGAGCAATATGCTGCTGGTTGTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010844.1-365s21c1
Sequence:CCGGGCCGTGTCCAGGAGTCTAATACTCGAGTATTAGACTCCTGGACACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)