EMAIL THIS PAGE TO A FRIEND

MUC6

mucin 6, oligomeric mucus/gel-forming

54 Gene Product Result for
Synonyms: MUC-6
Gene ID:
Human(4588) Summary: The MUC6 gene encodes gastric mucin, a secreted glycoprotein that plays an essential role in epithelial cytoprotection from acid, proteases, pathogenic microorganisms, and mechanical trauma in the gastrointestinal tract (summary by Toribara et al., 1993 [PubMed 7680650]
Mouse(353328) mucin 6, gastric
Rat(282586) mucin 6, oligomeric mucus/gel-forming
chicken(414878) mucin 6 oligomeric mucus/gel-forming (ovomucin, beta subunint)
cow(101903030) mucin 6, oligomeric mucus/gel-forming
domestic cat(101096845) mucin 6, oligomeric mucus/gel-forming
dog(483652) mucin 6, oligomeric mucus/gel-forming
domestic guinea pig(100724324) mucin 6, oligomeric mucus/gel-forming
naked mole-rat(101721134) mucin 6, oligomeric mucus/gel-forming
sheep(101121644) mucin 6, oligomeric mucus/gel-forming
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301182 Anti-MUC6 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181729 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181729 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181729 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005961 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005961 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005961 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005961 Rosetta Predictions human pricing
XM_290540 Rosetta Predictions human pricing
XM_001063115 Rosetta Predictions rat pricing
XM_215127 Rosetta Predictions rat pricing
NM_181729 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005961 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340624 predicted 6886
2 SASI_Hs02_00340625 predicted 4995
3 SASI_Hs02_00340626 predicted 1256
4 SASI_Hs02_00340627 predicted 3822
5 SASI_Hs02_00340628 predicted 4100
6 SASI_Hs02_00340629 predicted 6507
7 SASI_Hs02_00340630 predicted 5768
8 SASI_Hs02_00340631 predicted 5767
9 SASI_Hs02_00340632 predicted 2056
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_290540 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00281547 predicted 2972
2 SASI_Hs01_00281548 predicted 417
3 SASI_Hs01_00281549 predicted 4111
4 SASI_Hs01_00281550 predicted 2065
5 SASI_Hs01_00281551 predicted 4668
6 SASI_Hs01_00281552 predicted 4555
7 SASI_Hs01_00281553 predicted 2056
8 SASI_Hs01_00281554 predicted 4224
9 SASI_Hs01_00281555 predicted 430
10 SASI_Hs01_00281556 predicted 4226
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063115 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00305843 predicted 3161
2 SASI_Rn02_00305844 predicted 8326
3 SASI_Rn02_00305845 predicted 4101
4 SASI_Rn02_00305846 predicted 9675
5 SASI_Rn02_00305847 predicted 1538
6 SASI_Rn02_00305848 predicted 8402
7 SASI_Rn02_00305849 predicted 4168
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215127 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375807 predicted 1260
2 SASI_Rn02_00375808 predicted 3240
3 SASI_Rn02_00375809 predicted 5977
4 SASI_Rn02_00375810 predicted 3212
5 SASI_Rn02_00375811 predicted 8101
6 SASI_Rn02_00375812 predicted 2029
7 SASI_Rn02_00375813 predicted 7943
8 SASI_Rn02_00375814 predicted 1621
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181729 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150210 predicted 4669
2 SASI_Mm01_00150211 predicted 2353
3 SASI_Mm01_00150212 predicted 4707
4 SASI_Mm01_00150213 predicted 3160
5 SASI_Mm01_00150214 predicted 7591
6 SASI_Mm01_00150215 predicted 6503
7 SASI_Mm01_00150216 predicted 5732
8 SASI_Mm01_00150217 predicted 5043
9 SASI_Mm01_00150218 predicted 1566
10 SASI_Mm02_00349894 predicted 6755
11 SASI_Mm01_00150219 predicted 3075
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181729
MUC6 MISSION shRNA Bacterial Glycerol Stock
mucin 6, oligomeric mucus/gel-forming
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181729.2-7415s21c1
Sequence:CCGGCACCGATGAAGACCACGATTACTCGAGTAATCGTGGTCTTCATCGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181729.2-4396s21c1
Sequence:CCGGGTTAGTGCCAACTCAATTAAGCTCGAGCTTAATTGAGTTGGCACTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181729.2-4277s21c1
Sequence:CCGGCATTAGCGCCGAGTACTTATACTCGAGTATAAGTACTCGGCGCTAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181729.2-2127s21c1
Sequence:CCGGCCGCACGTTCAGCTATGATAGCTCGAGCTATCATAGCTGAACGTGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181729.1-7483s1c1
Sequence:CCGGGCCACATTATTTCCACCATTTCTCGAGAAATGGTGGAAATAATGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181729.1-3309s1c1
Sequence:CCGGCGAGCGTAAATGCAACATTATCTCGAGATAATGTTGCATTTACGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181729.1-3199s1c1
Sequence:CCGGGCGTCCAATGAACTGGAGTTTCTCGAGAAACTCCAGTTCATTGGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097695    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181729.1-8617s1c1
Sequence:CCGGCTAACACCTGTAACTCGCAATCTCGAGATTGCGAGTTACAGGTGTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181729.1-1575s1c1
Sequence:CCGGGCTGCCATACAAGACACACAACTCGAGTTGTGTGTCTTGTATGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181729
MUC6 MISSION shRNA shRNA Plasmid DNA
mucin 6, oligomeric mucus/gel-forming
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181729.2-7415s21c1
Sequence:CCGGCACCGATGAAGACCACGATTACTCGAGTAATCGTGGTCTTCATCGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181729.2-4396s21c1
Sequence:CCGGGTTAGTGCCAACTCAATTAAGCTCGAGCTTAATTGAGTTGGCACTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181729.2-4277s21c1
Sequence:CCGGCATTAGCGCCGAGTACTTATACTCGAGTATAAGTACTCGGCGCTAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181729.2-2127s21c1
Sequence:CCGGCCGCACGTTCAGCTATGATAGCTCGAGCTATCATAGCTGAACGTGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181729.1-7483s1c1
Sequence:CCGGGCCACATTATTTCCACCATTTCTCGAGAAATGGTGGAAATAATGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181729.1-3309s1c1
Sequence:CCGGCGAGCGTAAATGCAACATTATCTCGAGATAATGTTGCATTTACGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181729.1-3199s1c1
Sequence:CCGGGCGTCCAATGAACTGGAGTTTCTCGAGAAACTCCAGTTCATTGGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097695    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181729.1-8617s1c1
Sequence:CCGGCTAACACCTGTAACTCGCAATCTCGAGATTGCGAGTTACAGGTGTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181729.1-1575s1c1
Sequence:CCGGGCTGCCATACAAGACACACAACTCGAGTTGTGTGTCTTGTATGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181729
MUC6 MISSION shRNA Lentiviral Transduction Particles
mucin 6, oligomeric mucus/gel-forming
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181729.2-7415s21c1
Sequence:CCGGCACCGATGAAGACCACGATTACTCGAGTAATCGTGGTCTTCATCGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181729.2-4396s21c1
Sequence:CCGGGTTAGTGCCAACTCAATTAAGCTCGAGCTTAATTGAGTTGGCACTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181729.2-4277s21c1
Sequence:CCGGCATTAGCGCCGAGTACTTATACTCGAGTATAAGTACTCGGCGCTAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181729.2-2127s21c1
Sequence:CCGGCCGCACGTTCAGCTATGATAGCTCGAGCTATCATAGCTGAACGTGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181729.1-7483s1c1
Sequence:CCGGGCCACATTATTTCCACCATTTCTCGAGAAATGGTGGAAATAATGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181729.1-3309s1c1
Sequence:CCGGCGAGCGTAAATGCAACATTATCTCGAGATAATGTTGCATTTACGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181729.1-3199s1c1
Sequence:CCGGGCGTCCAATGAACTGGAGTTTCTCGAGAAACTCCAGTTCATTGGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097695    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181729.1-8617s1c1
Sequence:CCGGCTAACACCTGTAACTCGCAATCTCGAGATTGCGAGTTACAGGTGTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181729.1-1575s1c1
Sequence:CCGGGCTGCCATACAAGACACACAACTCGAGTTGTGTGTCTTGTATGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005961
MUC6 MISSION shRNA Bacterial Glycerol Stock
mucin 6, oligomeric mucus/gel-forming
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005961.1-538s1c1
Sequence:CCGGCTCACACAGTCATCATCACTACTCGAGTAGTGATGATGACTGTGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005961.2-3262s21c1
Sequence:CCGGACCTGCCACAGCAAGGTATACCTCGAGGTATACCTTGCTGTGGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005961.2-4667s21c1
Sequence:CCGGCAACTTCTACTACCACGATTACTCGAGTAATCGTGGTAGTAGAAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005961.2-593s21c1
Sequence:CCGGGGAAGGTGACCAACGAGTTTGCTCGAGCAAACTCGTTGGTCACCTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005961.2-1074s21c1
Sequence:CCGGCCTGAATGACCTCTCCAATAACTCGAGTTATTGGAGAGGTCATTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005961.2-1255s21c1
Sequence:CCGGGGCTCCTTTGTTACCACATTTCTCGAGAAATGTGGTAACAAAGGAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005961
MUC6 MISSION shRNA shRNA Plasmid DNA
mucin 6, oligomeric mucus/gel-forming
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005961.1-538s1c1
Sequence:CCGGCTCACACAGTCATCATCACTACTCGAGTAGTGATGATGACTGTGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005961.2-3262s21c1
Sequence:CCGGACCTGCCACAGCAAGGTATACCTCGAGGTATACCTTGCTGTGGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005961.2-4667s21c1
Sequence:CCGGCAACTTCTACTACCACGATTACTCGAGTAATCGTGGTAGTAGAAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005961.2-593s21c1
Sequence:CCGGGGAAGGTGACCAACGAGTTTGCTCGAGCAAACTCGTTGGTCACCTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005961.2-1074s21c1
Sequence:CCGGCCTGAATGACCTCTCCAATAACTCGAGTTATTGGAGAGGTCATTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005961.2-1255s21c1
Sequence:CCGGGGCTCCTTTGTTACCACATTTCTCGAGAAATGTGGTAACAAAGGAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005961
MUC6 MISSION shRNA Lentiviral Transduction Particles
mucin 6, oligomeric mucus/gel-forming
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005961.1-538s1c1
Sequence:CCGGCTCACACAGTCATCATCACTACTCGAGTAGTGATGATGACTGTGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005961.2-3262s21c1
Sequence:CCGGACCTGCCACAGCAAGGTATACCTCGAGGTATACCTTGCTGTGGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005961.2-4667s21c1
Sequence:CCGGCAACTTCTACTACCACGATTACTCGAGTAATCGTGGTAGTAGAAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005961.2-593s21c1
Sequence:CCGGGGAAGGTGACCAACGAGTTTGCTCGAGCAAACTCGTTGGTCACCTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005961.2-1074s21c1
Sequence:CCGGCCTGAATGACCTCTCCAATAACTCGAGTTATTGGAGAGGTCATTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005961.2-1255s21c1
Sequence:CCGGGGCTCCTTTGTTACCACATTTCTCGAGAAATGTGGTAACAAAGGAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)