EMAIL THIS PAGE TO A FRIEND

MUC7

mucin 7, secreted

46 Gene Product Result for
Synonyms: MG2
UniProtKB ID: Q8TAX7, Q9UCD7, Q9UCD8
Gene ID:
Human(4589) Summary: This gene encodes a small salivary mucin, which is thought to play a role in facilitating the clearance of bacteria in the oral cavity and to aid in mastication, speech, and swallowing. The central domain of this glycoprotein contains tandem repeats, each composed of 23 amino acids. The most common allele contains 6 repeats, and some alleles may be associated with susceptibility to asthma. Alternatively spliced transcript variants with different 5' UTR, but encoding the same protein, have been found for this gene.[provided by RefSeq, Feb 2009]
Rat(29587) mucin 10, submandibular gland salivary mucin
cow(101905278) mucin 7, secreted
domestic cat(101097558) mucin 7, secreted
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152291 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152291 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152291 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU039201 MISSION® esiRNA esiRNA human MUC7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152291 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152291 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060204 predicted 1298
2 SASI_Hs01_00060205 predicted 282
3 SASI_Hs01_00060206 predicted 1209
4 SASI_Hs01_00060207 predicted 1088
5 SASI_Hs01_00060208 predicted 257
6 SASI_Hs01_00060210 predicted 268
7 SASI_Hs01_00060211 predicted 391
8 SASI_Hs01_00060212 predicted 426
9 SASI_Hs01_00060213 predicted 222
10 SASI_Hs02_00365849 predicted 347
11 SASI_Hs01_00060209 predicted 1232
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152291
MUC7 MISSION shRNA Bacterial Glycerol Stock
mucin 7, secreted
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152291.2-314s21c1
Sequence:CCGGCACTTTGAATTACCACATTATCTCGAGATAATGTGGTAATTCAAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152291.2-1472s21c1
Sequence:CCGGACCACCACAAGACCTATTAACCTCGAGGTTAATAGGTCTTGTGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152291.2-409s21c1
Sequence:CCGGGCTTCCACCTTCACCTAATAACTCGAGTTATTAGGTGAAGGTGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152291.1-1968s1c1
Sequence:CCGGGCCTCTGTGAACAACAAGAATCTCGAGATTCTTGTTGTTCACAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152291.1-256s1c1
Sequence:CCGGGCCGTTCATTAGAAAGTCCTACTCGAGTAGGACTTTCTAATGAACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152291.1-1095s1c1
Sequence:CCGGCGGTCACTACTCAAACTACTACTCGAGTAGTAGTTTGAGTAGTGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152291.1-355s1c1
Sequence:CCGGGCCACCTAAACATCCAGATAACTCGAGTTATCTGGATGTTTAGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152291.1-498s1c1
Sequence:CCGGCCACCATATCTTCAAGAGAAACTCGAGTTTCTCTTGAAGATATGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152291
MUC7 MISSION shRNA shRNA Plasmid DNA
mucin 7, secreted
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152291.2-314s21c1
Sequence:CCGGCACTTTGAATTACCACATTATCTCGAGATAATGTGGTAATTCAAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152291.2-1472s21c1
Sequence:CCGGACCACCACAAGACCTATTAACCTCGAGGTTAATAGGTCTTGTGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152291.2-409s21c1
Sequence:CCGGGCTTCCACCTTCACCTAATAACTCGAGTTATTAGGTGAAGGTGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152291.1-1968s1c1
Sequence:CCGGGCCTCTGTGAACAACAAGAATCTCGAGATTCTTGTTGTTCACAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152291.1-256s1c1
Sequence:CCGGGCCGTTCATTAGAAAGTCCTACTCGAGTAGGACTTTCTAATGAACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152291.1-1095s1c1
Sequence:CCGGCGGTCACTACTCAAACTACTACTCGAGTAGTAGTTTGAGTAGTGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152291.1-355s1c1
Sequence:CCGGGCCACCTAAACATCCAGATAACTCGAGTTATCTGGATGTTTAGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152291.1-498s1c1
Sequence:CCGGCCACCATATCTTCAAGAGAAACTCGAGTTTCTCTTGAAGATATGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152291
MUC7 MISSION shRNA Lentiviral Transduction Particles
mucin 7, secreted
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152291.2-314s21c1
Sequence:CCGGCACTTTGAATTACCACATTATCTCGAGATAATGTGGTAATTCAAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152291.2-1472s21c1
Sequence:CCGGACCACCACAAGACCTATTAACCTCGAGGTTAATAGGTCTTGTGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152291.2-409s21c1
Sequence:CCGGGCTTCCACCTTCACCTAATAACTCGAGTTATTAGGTGAAGGTGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152291.1-1968s1c1
Sequence:CCGGGCCTCTGTGAACAACAAGAATCTCGAGATTCTTGTTGTTCACAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152291.1-256s1c1
Sequence:CCGGGCCGTTCATTAGAAAGTCCTACTCGAGTAGGACTTTCTAATGAACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152291.1-1095s1c1
Sequence:CCGGCGGTCACTACTCAAACTACTACTCGAGTAGTAGTTTGAGTAGTGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152291.1-355s1c1
Sequence:CCGGGCCACCTAAACATCCAGATAACTCGAGTTATCTGGATGTTTAGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152291.1-498s1c1
Sequence:CCGGCCACCATATCTTCAAGAGAAACTCGAGTTTCTCTTGAAGATATGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)