EMAIL THIS PAGE TO A FRIEND

MUCL1

mucin-like 1

34 Gene Product Result for
Synonyms: SBEM
UniProtKB ID: Q96DR8, Q0VG95, Q32ZB5
Gene ID:
Mouse(20771) mucin-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_058173 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_058173 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_058173 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009268 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009268 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009268 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU055931 MISSION® esiRNA esiRNA human MUCL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_058173 Rosetta Predictions human pricing
NM_009268 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058173 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200587 predicted 68
2 SASI_Hs01_00200588 predicted 363
3 SASI_Hs01_00200589 predicted 345
4 SASI_Hs02_00362074 predicted 395
5 SASI_Hs01_00200591 predicted 84
6 SASI_Hs01_00200592 predicted 350
7 SASI_Hs01_00200593 predicted 340
8 SASI_Hs01_00200594 predicted 381
9 SASI_Hs01_00200595 predicted 85
10 SASI_Hs01_00200596 predicted 336
11 SASI_Hs01_00200590 predicted 81
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009268 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169235 predicted 244
2 SASI_Mm01_00169237 predicted 253
3 SASI_Mm02_00315753 predicted 246
4 SASI_Mm02_00315754 predicted 228
5 SASI_Mm02_00315755 predicted 264
6 SASI_Mm01_00169233 predicted 198
7 SASI_Mm01_00169239 predicted 228
8 SASI_Mm02_00315756 predicted 209
9 SASI_Mm02_00315757 predicted 265
10 SASI_Mm02_00315758 predicted 266
11 SASI_Mm01_00169231 predicted 291
12 SASI_Mm01_00169232 predicted 222
13 SASI_Mm01_00169234 predicted 224
14 SASI_Mm01_00169236 predicted 222
15 SASI_Mm01_00169238 predicted 301
16 SASI_Mm01_00169240 predicted 310
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_058173
MUCL1 MISSION shRNA Bacterial Glycerol Stock
mucin-like 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058173.2-316s21c1
Sequence:CCGGTCCCGAATGGTAGAGTGTGTCCTCGAGGACACACTCTACCATTCGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058173.2-103s21c1
Sequence:CCGGTTTCCATCTTTCTGGTCTCTGCTCGAGCAGAGACCAGAAAGATGGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058173.2-167s21c1
Sequence:CCGGTACTGGTCCTGCTGATGATGACTCGAGTCATCATCAGCAGGACCAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058173.1-101s1c2
Sequence:UNK
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058173.2-330s21c1
Sequence:CCGGGTGTGTCCCTGAGATGGAATCCTCGAGGATTCCATCTCAGGGACACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058173.1-243s1c1
Sequence:CCGGCTACCACTGCTCGTAAAGACACTCGAGTGTCTTTACGAGCAGTGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058173.1-128s1c1
Sequence:CCGGGCTGACACGTATCCAGCTACTCTCGAGAGTAGCTGGATACGTGTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058173.1-122s1c1
Sequence:CCGGGCTCCAGCTGACACGTATCCACTCGAGTGGATACGTGTCAGCTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058173.1-191s1c1
Sequence:CCGGGCTGCAACCACTGCGACCACTCTCGAGAGTGGTCGCAGTGGTTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_058173
MUCL1 MISSION shRNA shRNA Plasmid DNA
mucin-like 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058173.2-316s21c1
Sequence:CCGGTCCCGAATGGTAGAGTGTGTCCTCGAGGACACACTCTACCATTCGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058173.2-103s21c1
Sequence:CCGGTTTCCATCTTTCTGGTCTCTGCTCGAGCAGAGACCAGAAAGATGGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058173.2-167s21c1
Sequence:CCGGTACTGGTCCTGCTGATGATGACTCGAGTCATCATCAGCAGGACCAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058173.1-101s1c2
Sequence:UNK
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058173.2-330s21c1
Sequence:CCGGGTGTGTCCCTGAGATGGAATCCTCGAGGATTCCATCTCAGGGACACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058173.1-243s1c1
Sequence:CCGGCTACCACTGCTCGTAAAGACACTCGAGTGTCTTTACGAGCAGTGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058173.1-128s1c1
Sequence:CCGGGCTGACACGTATCCAGCTACTCTCGAGAGTAGCTGGATACGTGTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058173.1-122s1c1
Sequence:CCGGGCTCCAGCTGACACGTATCCACTCGAGTGGATACGTGTCAGCTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058173.1-191s1c1
Sequence:CCGGGCTGCAACCACTGCGACCACTCTCGAGAGTGGTCGCAGTGGTTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_058173
MUCL1 MISSION shRNA Lentiviral Transduction Particles
mucin-like 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058173.2-316s21c1
Sequence:CCGGTCCCGAATGGTAGAGTGTGTCCTCGAGGACACACTCTACCATTCGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058173.2-103s21c1
Sequence:CCGGTTTCCATCTTTCTGGTCTCTGCTCGAGCAGAGACCAGAAAGATGGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058173.2-167s21c1
Sequence:CCGGTACTGGTCCTGCTGATGATGACTCGAGTCATCATCAGCAGGACCAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058173.1-101s1c2
Sequence:UNK
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058173.2-330s21c1
Sequence:CCGGGTGTGTCCCTGAGATGGAATCCTCGAGGATTCCATCTCAGGGACACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058173.1-243s1c1
Sequence:CCGGCTACCACTGCTCGTAAAGACACTCGAGTGTCTTTACGAGCAGTGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058173.1-128s1c1
Sequence:CCGGGCTGACACGTATCCAGCTACTCTCGAGAGTAGCTGGATACGTGTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058173.1-122s1c1
Sequence:CCGGGCTCCAGCTGACACGTATCCACTCGAGTGGATACGTGTCAGCTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058173.1-191s1c1
Sequence:CCGGGCTGCAACCACTGCGACCACTCTCGAGAGTGGTCGCAGTGGTTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009268
MUCL1 MISSION shRNA Bacterial Glycerol Stock
mucin-like 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009268.1-228s21c1
Sequence:CCGGACTCAGGCAGATAGTACTAATCTCGAGATTAGTACTATCTGCCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009268.1-163s1c1
Sequence:CCGGCGGAGACAAACAGTGCTGAAACTCGAGTTTCAGCACTGTTTGTCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009268.1-357s1c1
Sequence:CCGGGATGATAACATTACCAGGGAACTCGAGTTCCCTGGTAATGTTATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009268.1-123s1c1
Sequence:CCGGCCGGAGACAAACAGTACTGAACTCGAGTTCAGTACTGTTTGTCTCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009268.1-453s21c1
Sequence:CCGGGAGGATGATACCTCCAATAACCTCGAGGTTATTGGAGGTATCATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009268.1-349s21c1
Sequence:CCGGGAGAGACAGATGATAACATTACTCGAGTAATGTTATCATCTGTCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009268.1-523s21c1
Sequence:CCGGATGAGAAACAAGAGGATAATACTCGAGTATTATCCTCTTGTTTCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009268.1-258s21c1
Sequence:CCGGGATGCTGAGTCCTCTAATTTACTCGAGTAAATTAGAGGACTCAGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009268
MUCL1 MISSION shRNA shRNA Plasmid DNA
mucin-like 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009268.1-228s21c1
Sequence:CCGGACTCAGGCAGATAGTACTAATCTCGAGATTAGTACTATCTGCCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009268.1-163s1c1
Sequence:CCGGCGGAGACAAACAGTGCTGAAACTCGAGTTTCAGCACTGTTTGTCTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009268.1-357s1c1
Sequence:CCGGGATGATAACATTACCAGGGAACTCGAGTTCCCTGGTAATGTTATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009268.1-123s1c1
Sequence:CCGGCCGGAGACAAACAGTACTGAACTCGAGTTCAGTACTGTTTGTCTCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009268.1-453s21c1
Sequence:CCGGGAGGATGATACCTCCAATAACCTCGAGGTTATTGGAGGTATCATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009268.1-349s21c1
Sequence:CCGGGAGAGACAGATGATAACATTACTCGAGTAATGTTATCATCTGTCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009268.1-523s21c1
Sequence:CCGGATGAGAAACAAGAGGATAATACTCGAGTATTATCCTCTTGTTTCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009268.1-258s21c1
Sequence:CCGGGATGCTGAGTCCTCTAATTTACTCGAGTAAATTAGAGGACTCAGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009268
MUCL1 MISSION shRNA Lentiviral Transduction Particles
mucin-like 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009268.1-228s21c1
Sequence:CCGGACTCAGGCAGATAGTACTAATCTCGAGATTAGTACTATCTGCCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009268.1-163s1c1
Sequence:CCGGCGGAGACAAACAGTGCTGAAACTCGAGTTTCAGCACTGTTTGTCTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009268.1-357s1c1
Sequence:CCGGGATGATAACATTACCAGGGAACTCGAGTTCCCTGGTAATGTTATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009268.1-123s1c1
Sequence:CCGGCCGGAGACAAACAGTACTGAACTCGAGTTCAGTACTGTTTGTCTCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009268.1-453s21c1
Sequence:CCGGGAGGATGATACCTCCAATAACCTCGAGGTTATTGGAGGTATCATCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009268.1-349s21c1
Sequence:CCGGGAGAGACAGATGATAACATTACTCGAGTAATGTTATCATCTGTCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009268.1-523s21c1
Sequence:CCGGATGAGAAACAAGAGGATAATACTCGAGTATTATCCTCTTGTTTCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009268.1-258s21c1
Sequence:CCGGGATGCTGAGTCCTCTAATTTACTCGAGTAAATTAGAGGACTCAGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)