EMAIL THIS PAGE TO A FRIEND

MUL1

mitochondrial E3 ubiquitin protein ligase 1

80 Gene Product Result for
Synonyms: C1orf166 GIDE MAPL MULAN RNF218 RP11-401M16.2
UniProtKB ID: Q969V5, B5M497, Q7Z431, Q9H9B5
Gene ID:
Mouse(68350) mitochondrial ubiquitin ligase activator of NFKB 1
Rat(298576) mitochondrial E3 ubiquitin protein ligase 1
fruit fly(38472) Mitochondrial E3 ubiquitin protein ligase 1 homologue
chicken(426969) mitochondrial E3 ubiquitin protein ligase 1
cow(508406) mitochondrial E3 ubiquitin protein ligase 1
dog(487394) mitochondrial E3 ubiquitin protein ligase 1
Horse(100058446) mitochondrial E3 ubiquitin protein ligase 1
domestic cat(101092776) mitochondrial E3 ubiquitin protein ligase 1
sheep(101106408) mitochondrial E3 ubiquitin protein ligase 1
domestic guinea pig(100721068) mitochondrial E3 ubiquitin protein ligase 1
naked mole-rat(101713474) mitochondrial E3 ubiquitin protein ligase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026689 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026689 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026689 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024544 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024544 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024544 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU131781 MISSION® esiRNA esiRNA human MUL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024544 Rosetta Predictions human pricing
NM_001106695 Rosetta Predictions rat pricing
NM_026689 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024544 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083230 predicted 1477
2 SASI_Hs01_00083231 predicted 1162
3 SASI_Hs01_00083232 predicted 1200
4 SASI_Hs01_00083236 predicted 1503
5 SASI_Hs02_00356842 predicted 605
6 SASI_Hs01_00083238 predicted 633
7 SASI_Hs01_00083239 predicted 297
8 SASI_Hs02_00356843 predicted 477
9 SASI_Hs02_00356844 predicted 1325
10 SASI_Hs02_00356845 predicted 1337
11 SASI_Hs01_00083233 predicted 598
12 SASI_Hs01_00083234 predicted 380
13 SASI_Hs01_00083235 predicted 1704
14 SASI_Hs01_00083237 predicted 1306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106695 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221478 predicted 1013
2 SASI_Rn02_00221479 predicted 269
3 SASI_Rn02_00221480 predicted 409
4 SASI_Rn02_00221481 predicted 454
5 SASI_Rn02_00221482 predicted 207
6 SASI_Rn02_00221483 predicted 305
7 SASI_Rn02_00221484 predicted 1053
8 SASI_Rn02_00221485 predicted 1070
9 SASI_Rn02_00221486 predicted 545
10 SASI_Rn02_00221487 predicted 213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026689 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177428 predicted 292
2 SASI_Mm01_00177429 predicted 201
3 SASI_Mm01_00177430 predicted 1089
4 SASI_Mm01_00177431 predicted 447
5 SASI_Mm01_00177432 predicted 534
6 SASI_Mm01_00177434 predicted 404
7 SASI_Mm01_00177435 predicted 1160
8 SASI_Mm01_00177436 predicted 1060
9 SASI_Mm01_00177437 predicted 395
10 SASI_Mm02_00330725 predicted 989
11 SASI_Mm01_00177433 predicted 199
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026689
VALIDATED
MUL1 MISSION shRNA Bacterial Glycerol Stock
mitochondrial E3 ubiquitin protein ligase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026689.3-2398s1c1
Sequence:CCGGGCGTGGGTCAAGAGGATATTACTCGAGTAATATCCTCTTGACCCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026689.3-850s1c1
Sequence:CCGGCCTCTTCTTCATCCTGAGGAACTCGAGTTCCTCAGGATGAAGAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026689.3-1119s1c1
Sequence:CCGGCCAGGGTGATACCCTTGTATACTCGAGTATACAAGGGTATCACCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026689.3-408s1c1
Sequence:CCGGCCCACCTTTGGAATGACTATTCTCGAGAATAGTCATTCCAAAGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026689.3-154s1c1
Sequence:CCGGCGCCGTACTGTACTCCATATACTCGAGTATATGGAGTACAGTACGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026689.3-1605s21c1
Sequence:CCGGCCCTCTATTTCCCTTACTTACCTCGAGGTAAGTAAGGGAAATAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026689.3-223s21c1
Sequence:CCGGTCATCTGGGTGAAGATTTAAACTCGAGTTTAAATCTTCACCCAGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026689.3-155s21c1
Sequence:CCGGGCCGTACTGTACTCCATATACCTCGAGGTATATGGAGTACAGTACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026689.3-368s21c1
Sequence:CCGGCTGTCGCTTCAGGAGCATAAGCTCGAGCTTATGCTCCTGAAGCGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026689.3-420s21c1
Sequence:CCGGATGACTATTCCAAGATCATTCCTCGAGGAATGATCTTGGAATAGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026689
VALIDATED
MUL1 MISSION shRNA shRNA Plasmid DNA
mitochondrial E3 ubiquitin protein ligase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026689.3-2398s1c1
Sequence:CCGGGCGTGGGTCAAGAGGATATTACTCGAGTAATATCCTCTTGACCCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026689.3-850s1c1
Sequence:CCGGCCTCTTCTTCATCCTGAGGAACTCGAGTTCCTCAGGATGAAGAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026689.3-1119s1c1
Sequence:CCGGCCAGGGTGATACCCTTGTATACTCGAGTATACAAGGGTATCACCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026689.3-408s1c1
Sequence:CCGGCCCACCTTTGGAATGACTATTCTCGAGAATAGTCATTCCAAAGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026689.3-154s1c1
Sequence:CCGGCGCCGTACTGTACTCCATATACTCGAGTATATGGAGTACAGTACGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026689.3-1605s21c1
Sequence:CCGGCCCTCTATTTCCCTTACTTACCTCGAGGTAAGTAAGGGAAATAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026689.3-223s21c1
Sequence:CCGGTCATCTGGGTGAAGATTTAAACTCGAGTTTAAATCTTCACCCAGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026689.3-155s21c1
Sequence:CCGGGCCGTACTGTACTCCATATACCTCGAGGTATATGGAGTACAGTACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026689.3-368s21c1
Sequence:CCGGCTGTCGCTTCAGGAGCATAAGCTCGAGCTTATGCTCCTGAAGCGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026689.3-420s21c1
Sequence:CCGGATGACTATTCCAAGATCATTCCTCGAGGAATGATCTTGGAATAGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026689
VALIDATED
MUL1 MISSION shRNA Lentiviral Transduction Particles
mitochondrial E3 ubiquitin protein ligase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026689.3-2398s1c1
Sequence:CCGGGCGTGGGTCAAGAGGATATTACTCGAGTAATATCCTCTTGACCCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026689.3-850s1c1
Sequence:CCGGCCTCTTCTTCATCCTGAGGAACTCGAGTTCCTCAGGATGAAGAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026689.3-1119s1c1
Sequence:CCGGCCAGGGTGATACCCTTGTATACTCGAGTATACAAGGGTATCACCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026689.3-408s1c1
Sequence:CCGGCCCACCTTTGGAATGACTATTCTCGAGAATAGTCATTCCAAAGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026689.3-154s1c1
Sequence:CCGGCGCCGTACTGTACTCCATATACTCGAGTATATGGAGTACAGTACGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026689.3-1605s21c1
Sequence:CCGGCCCTCTATTTCCCTTACTTACCTCGAGGTAAGTAAGGGAAATAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026689.3-223s21c1
Sequence:CCGGTCATCTGGGTGAAGATTTAAACTCGAGTTTAAATCTTCACCCAGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026689.3-155s21c1
Sequence:CCGGGCCGTACTGTACTCCATATACCTCGAGGTATATGGAGTACAGTACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026689.3-368s21c1
Sequence:CCGGCTGTCGCTTCAGGAGCATAAGCTCGAGCTTATGCTCCTGAAGCGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026689.3-420s21c1
Sequence:CCGGATGACTATTCCAAGATCATTCCTCGAGGAATGATCTTGGAATAGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024544
VALIDATED
MUL1 MISSION shRNA Bacterial Glycerol Stock
mitochondrial E3 ubiquitin protein ligase 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024544.1-360s1c1
Sequence:CCGGCGGTCTGTTAAAGAAACGCTTCTCGAGAAGCGTTTCTTTAACAGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024544.1-800s1c1
Sequence:CCGGCTATCTAAGCAGCCAGGACTTCTCGAGAAGTCCTGGCTGCTTAGATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024544.1-372s1c1
Sequence:CCGGGAAACGCTTAACAGCCAGTTTCTCGAGAAACTGGCTGTTAAGCGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_024544.1-1136s1c1
Sequence:CCGGAGAACCCAAGAAGTGCCCTATCTCGAGATAGGGCACTTCTTGGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024544.2-340s21c1
Sequence:CCGGATGCGTGCCTTATGCTGTTATCTCGAGATAACAGCATAAGGCACGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024544.2-802s21c1
Sequence:CCGGAGGCATGCAGTACTATCTAAGCTCGAGCTTAGATAGTACTGCATGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024544.2-365s21c1
Sequence:CCGGGGAGCTGTGCGGTCTGTTAAACTCGAGTTTAACAGACCGCACAGCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024544.2-1314s21c1
Sequence:CCGGTGTCACCTCCAGGTATGATTGCTCGAGCAATCATACCTGGAGGTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024544
VALIDATED
MUL1 MISSION shRNA shRNA Plasmid DNA
mitochondrial E3 ubiquitin protein ligase 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024544.1-360s1c1
Sequence:CCGGCGGTCTGTTAAAGAAACGCTTCTCGAGAAGCGTTTCTTTAACAGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024544.1-800s1c1
Sequence:CCGGCTATCTAAGCAGCCAGGACTTCTCGAGAAGTCCTGGCTGCTTAGATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024544.1-372s1c1
Sequence:CCGGGAAACGCTTAACAGCCAGTTTCTCGAGAAACTGGCTGTTAAGCGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_024544.1-1136s1c1
Sequence:CCGGAGAACCCAAGAAGTGCCCTATCTCGAGATAGGGCACTTCTTGGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024544.2-340s21c1
Sequence:CCGGATGCGTGCCTTATGCTGTTATCTCGAGATAACAGCATAAGGCACGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024544.2-802s21c1
Sequence:CCGGAGGCATGCAGTACTATCTAAGCTCGAGCTTAGATAGTACTGCATGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024544.2-365s21c1
Sequence:CCGGGGAGCTGTGCGGTCTGTTAAACTCGAGTTTAACAGACCGCACAGCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024544.2-1314s21c1
Sequence:CCGGTGTCACCTCCAGGTATGATTGCTCGAGCAATCATACCTGGAGGTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024544
VALIDATED
MUL1 MISSION shRNA Lentiviral Transduction Particles
mitochondrial E3 ubiquitin protein ligase 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024544.1-360s1c1
Sequence:CCGGCGGTCTGTTAAAGAAACGCTTCTCGAGAAGCGTTTCTTTAACAGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024544.1-800s1c1
Sequence:CCGGCTATCTAAGCAGCCAGGACTTCTCGAGAAGTCCTGGCTGCTTAGATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024544.1-372s1c1
Sequence:CCGGGAAACGCTTAACAGCCAGTTTCTCGAGAAACTGGCTGTTAAGCGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_024544.1-1136s1c1
Sequence:CCGGAGAACCCAAGAAGTGCCCTATCTCGAGATAGGGCACTTCTTGGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024544.2-340s21c1
Sequence:CCGGATGCGTGCCTTATGCTGTTATCTCGAGATAACAGCATAAGGCACGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024544.2-802s21c1
Sequence:CCGGAGGCATGCAGTACTATCTAAGCTCGAGCTTAGATAGTACTGCATGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024544.2-365s21c1
Sequence:CCGGGGAGCTGTGCGGTCTGTTAAACTCGAGTTTAACAGACCGCACAGCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024544.2-1314s21c1
Sequence:CCGGTGTCACCTCCAGGTATGATTGCTCGAGCAATCATACCTGGAGGTGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)