EMAIL THIS PAGE TO A FRIEND

MUM1

melanoma associated antigen (mutated) 1

51 Gene Product Result for
Synonyms: EXPAND1 HSPC211 MUM-1
Gene ID:
Mouse(68114) melanoma associated antigen (mutated) 1
Rat(362838) melanoma associated antigen (mutated) 1
chicken(425514) melanoma associated antigen (mutated) 1
cow(513471) melanoma associated antigen (mutated) 1
dog(612320) melanoma associated antigen (mutated) 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023431 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023431 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023431 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032853 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032853 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032853 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032853 Rosetta Predictions human pricing
NM_001108736 Rosetta Predictions rat pricing
NM_023431 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032853 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190096 predicted 1599
2 SASI_Hs01_00190097 predicted 874
3 SASI_Hs01_00190098 predicted 1432
4 SASI_Hs01_00190099 predicted 350
5 SASI_Hs01_00190100 predicted 670
6 SASI_Hs01_00190101 predicted 392
7 SASI_Hs01_00190102 predicted 1425
8 SASI_Hs01_00190103 predicted 495
9 SASI_Hs01_00190104 predicted 355
10 SASI_Hs02_00360449 predicted 1579
11 SASI_Hs01_00190105 predicted 1418
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108736 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241575 predicted 1734
2 SASI_Rn02_00241576 predicted 2111
3 SASI_Rn02_00241577 predicted 447
4 SASI_Rn02_00241578 predicted 396
5 SASI_Rn02_00241579 predicted 491
6 SASI_Rn02_00241580 predicted 1419
7 SASI_Rn02_00241581 predicted 377
8 SASI_Rn02_00241582 predicted 1580
9 SASI_Rn02_00241583 predicted 450
10 SASI_Rn02_00241584 predicted 1474
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023431 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327114 predicted 271
2 SASI_Mm01_00125264 predicted 2137
3 SASI_Mm01_00125265 predicted 2157
4 SASI_Mm01_00125266 predicted 498
5 SASI_Mm02_00327115 predicted 261
6 SASI_Mm01_00125268 predicted 497
7 SASI_Mm01_00125269 predicted 467
8 SASI_Mm01_00125270 predicted 1596
9 SASI_Mm01_00125271 predicted 975
10 SASI_Mm01_00125272 predicted 532
11 SASI_Mm01_00125267 predicted 1960
12 SASI_Mm01_00125273 predicted 1436
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023431
VALIDATED
MUM1 MISSION shRNA Bacterial Glycerol Stock
melanoma associated antigen (mutated) 1
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023431.5-737s21c1
Sequence:CCGGAGACAAGTCTCAGGATGATTCCTCGAGGAATCATCCTGAGACTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340194    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023431.5-2601s21c1
Sequence:CCGGATGTTGCCCTGGCATTCATTGCTCGAGCAATGAATGCCAGGGCAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023431.5-2116s21c1
Sequence:CCGGCAGCCGAGCAGAAGTACATTCCTCGAGGAATGTACTTCTGCTCGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023431.5-1635s21c1
Sequence:CCGGTACCCTGTGCGCAAGTCTATCCTCGAGGATAGACTTGCGCACAGGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023431.5-1318s21c1
Sequence:CCGGGAATGCTGGTCTGGCTTAAATCTCGAGATTTAAGCCAGACCAGCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023431.5-658s21c1
Sequence:CCGGTGTTGCCGTCGTCTGCATTAGCTCGAGCTAATGCAGACGACGGCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023431.5-349s21c1
Sequence:CCGGAGTCGCACATTGAGAACATTGCTCGAGCAATGTTCTCAATGTGCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023431.5-1290s21c1
Sequence:CCGGTATCACGAACCACGGTCATTTCTCGAGAAATGACCGTGGTTCGTGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215881    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023431.5-2613s1c1
Sequence:CCGGCATTCATTGTTCTGCTTATTTCTCGAGAAATAAGCAGAACAATGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023431.5-1610s1c1
Sequence:CCGGGGAATACTACGCTGCTGATATCTCGAGATATCAGCAGCGTAGTATTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023431.5-1318s1c1
Sequence:CCGGGAATGCTGGTCTGGCTTAAATCTCGAGATTTAAGCCAGACCAGCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023431.5-3414s21c1
Sequence:CCGGATTTGAGGTATCAGAATATTGCTCGAGCAATATTCTGATACCTCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023431.5-480s21c1
Sequence:CCGGAGTCCTGAAAGTCATCCAATACTCGAGTATTGGATGACTTTCAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023431.3-566s1c1
Sequence:CCGGCCAAGGGAGAAAGTGTCTTAACTCGAGTTAAGACACTTTCTCCCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023431
VALIDATED
MUM1 MISSION shRNA shRNA Plasmid DNA
melanoma associated antigen (mutated) 1
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023431.5-737s21c1
Sequence:CCGGAGACAAGTCTCAGGATGATTCCTCGAGGAATCATCCTGAGACTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340194    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023431.5-2601s21c1
Sequence:CCGGATGTTGCCCTGGCATTCATTGCTCGAGCAATGAATGCCAGGGCAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023431.5-2116s21c1
Sequence:CCGGCAGCCGAGCAGAAGTACATTCCTCGAGGAATGTACTTCTGCTCGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023431.5-1635s21c1
Sequence:CCGGTACCCTGTGCGCAAGTCTATCCTCGAGGATAGACTTGCGCACAGGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023431.5-1318s21c1
Sequence:CCGGGAATGCTGGTCTGGCTTAAATCTCGAGATTTAAGCCAGACCAGCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023431.5-658s21c1
Sequence:CCGGTGTTGCCGTCGTCTGCATTAGCTCGAGCTAATGCAGACGACGGCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023431.5-349s21c1
Sequence:CCGGAGTCGCACATTGAGAACATTGCTCGAGCAATGTTCTCAATGTGCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023431.5-1290s21c1
Sequence:CCGGTATCACGAACCACGGTCATTTCTCGAGAAATGACCGTGGTTCGTGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215881    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023431.5-2613s1c1
Sequence:CCGGCATTCATTGTTCTGCTTATTTCTCGAGAAATAAGCAGAACAATGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023431.5-1610s1c1
Sequence:CCGGGGAATACTACGCTGCTGATATCTCGAGATATCAGCAGCGTAGTATTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023431.5-1318s1c1
Sequence:CCGGGAATGCTGGTCTGGCTTAAATCTCGAGATTTAAGCCAGACCAGCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023431.5-3414s21c1
Sequence:CCGGATTTGAGGTATCAGAATATTGCTCGAGCAATATTCTGATACCTCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023431.5-480s21c1
Sequence:CCGGAGTCCTGAAAGTCATCCAATACTCGAGTATTGGATGACTTTCAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023431.3-566s1c1
Sequence:CCGGCCAAGGGAGAAAGTGTCTTAACTCGAGTTAAGACACTTTCTCCCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023431
VALIDATED
MUM1 MISSION shRNA Lentiviral Transduction Particles
melanoma associated antigen (mutated) 1
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023431.5-737s21c1
Sequence:CCGGAGACAAGTCTCAGGATGATTCCTCGAGGAATCATCCTGAGACTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340194    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023431.5-2601s21c1
Sequence:CCGGATGTTGCCCTGGCATTCATTGCTCGAGCAATGAATGCCAGGGCAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023431.5-2116s21c1
Sequence:CCGGCAGCCGAGCAGAAGTACATTCCTCGAGGAATGTACTTCTGCTCGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023431.5-1635s21c1
Sequence:CCGGTACCCTGTGCGCAAGTCTATCCTCGAGGATAGACTTGCGCACAGGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023431.5-1318s21c1
Sequence:CCGGGAATGCTGGTCTGGCTTAAATCTCGAGATTTAAGCCAGACCAGCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023431.5-658s21c1
Sequence:CCGGTGTTGCCGTCGTCTGCATTAGCTCGAGCTAATGCAGACGACGGCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023431.5-349s21c1
Sequence:CCGGAGTCGCACATTGAGAACATTGCTCGAGCAATGTTCTCAATGTGCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023431.5-1290s21c1
Sequence:CCGGTATCACGAACCACGGTCATTTCTCGAGAAATGACCGTGGTTCGTGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215881    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023431.5-2613s1c1
Sequence:CCGGCATTCATTGTTCTGCTTATTTCTCGAGAAATAAGCAGAACAATGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023431.5-1610s1c1
Sequence:CCGGGGAATACTACGCTGCTGATATCTCGAGATATCAGCAGCGTAGTATTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023431.5-1318s1c1
Sequence:CCGGGAATGCTGGTCTGGCTTAAATCTCGAGATTTAAGCCAGACCAGCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023431.5-3414s21c1
Sequence:CCGGATTTGAGGTATCAGAATATTGCTCGAGCAATATTCTGATACCTCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023431.5-480s21c1
Sequence:CCGGAGTCCTGAAAGTCATCCAATACTCGAGTATTGGATGACTTTCAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023431.3-566s1c1
Sequence:CCGGCCAAGGGAGAAAGTGTCTTAACTCGAGTTAAGACACTTTCTCCCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032853
VALIDATED
MUM1 MISSION shRNA Bacterial Glycerol Stock
melanoma associated antigen (mutated) 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276243    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032853.3-2398s21c1
Sequence:CCGGCTGGAGAATCCATTTCGTTAACTCGAGTTAACGAAATGGATTCTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032853.3-284s21c1
Sequence:CCGGGATCCTAGAGAAGTCTCAAATCTCGAGATTTGAGACTTCTCTAGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032853.3-589s21c1
Sequence:CCGGGCCTGTCAAGTTCGTTCACTTCTCGAGAAGTGAACGAACTTGACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032853.3-1640s21c1
Sequence:CCGGGGAATATTACGCGGCTGATATCTCGAGATATCAGCCGCGTAATATTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032853.3-1419s21c1
Sequence:CCGGGATAAGAAAGCAAGTGTGCTACTCGAGTAGCACACTTGCTTTCTTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032853.2-670s1c1
Sequence:CCGGGCCTGTCAAGTTCGTTCACTTCTCGAGAAGTGAACGAACTTGACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136313    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032853.2-363s1c1
Sequence:CCGGGAGATCCTAGAGAAGTCTCAACTCGAGTTGAGACTTCTCTAGGATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032853.2-1500s1c1
Sequence:CCGGGATAAGAAAGCAAGTGTGCTACTCGAGTAGCACACTTGCTTTCTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133732    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032853.2-2677s1c1
Sequence:CCGGCTGATATTAAACGGGAGGTTTCTCGAGAAACCTCCCGTTTAATATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032853.2-676s1c1
Sequence:CCGGCAAGTTCGTTCACTTGTGAAACTCGAGTTTCACAAGTGAACGAACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032853.2-3622s1c1
Sequence:CCGGCGGAACACGATTGTCTCAGATCTCGAGATCTGAGACAATCGTGTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032853
VALIDATED
MUM1 MISSION shRNA shRNA Plasmid DNA
melanoma associated antigen (mutated) 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276243    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032853.3-2398s21c1
Sequence:CCGGCTGGAGAATCCATTTCGTTAACTCGAGTTAACGAAATGGATTCTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032853.3-284s21c1
Sequence:CCGGGATCCTAGAGAAGTCTCAAATCTCGAGATTTGAGACTTCTCTAGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032853.3-589s21c1
Sequence:CCGGGCCTGTCAAGTTCGTTCACTTCTCGAGAAGTGAACGAACTTGACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032853.3-1640s21c1
Sequence:CCGGGGAATATTACGCGGCTGATATCTCGAGATATCAGCCGCGTAATATTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032853.3-1419s21c1
Sequence:CCGGGATAAGAAAGCAAGTGTGCTACTCGAGTAGCACACTTGCTTTCTTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032853.2-670s1c1
Sequence:CCGGGCCTGTCAAGTTCGTTCACTTCTCGAGAAGTGAACGAACTTGACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136313    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032853.2-363s1c1
Sequence:CCGGGAGATCCTAGAGAAGTCTCAACTCGAGTTGAGACTTCTCTAGGATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032853.2-1500s1c1
Sequence:CCGGGATAAGAAAGCAAGTGTGCTACTCGAGTAGCACACTTGCTTTCTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133732    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032853.2-2677s1c1
Sequence:CCGGCTGATATTAAACGGGAGGTTTCTCGAGAAACCTCCCGTTTAATATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032853.2-676s1c1
Sequence:CCGGCAAGTTCGTTCACTTGTGAAACTCGAGTTTCACAAGTGAACGAACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032853.2-3622s1c1
Sequence:CCGGCGGAACACGATTGTCTCAGATCTCGAGATCTGAGACAATCGTGTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032853
VALIDATED
MUM1 MISSION shRNA Lentiviral Transduction Particles
melanoma associated antigen (mutated) 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276243    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032853.3-2398s21c1
Sequence:CCGGCTGGAGAATCCATTTCGTTAACTCGAGTTAACGAAATGGATTCTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032853.3-284s21c1
Sequence:CCGGGATCCTAGAGAAGTCTCAAATCTCGAGATTTGAGACTTCTCTAGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032853.3-589s21c1
Sequence:CCGGGCCTGTCAAGTTCGTTCACTTCTCGAGAAGTGAACGAACTTGACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032853.3-1640s21c1
Sequence:CCGGGGAATATTACGCGGCTGATATCTCGAGATATCAGCCGCGTAATATTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032853.3-1419s21c1
Sequence:CCGGGATAAGAAAGCAAGTGTGCTACTCGAGTAGCACACTTGCTTTCTTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032853.2-670s1c1
Sequence:CCGGGCCTGTCAAGTTCGTTCACTTCTCGAGAAGTGAACGAACTTGACAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136313    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032853.2-363s1c1
Sequence:CCGGGAGATCCTAGAGAAGTCTCAACTCGAGTTGAGACTTCTCTAGGATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032853.2-1500s1c1
Sequence:CCGGGATAAGAAAGCAAGTGTGCTACTCGAGTAGCACACTTGCTTTCTTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133732    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032853.2-2677s1c1
Sequence:CCGGCTGATATTAAACGGGAGGTTTCTCGAGAAACCTCCCGTTTAATATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032853.2-676s1c1
Sequence:CCGGCAAGTTCGTTCACTTGTGAAACTCGAGTTTCACAAGTGAACGAACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032853.2-3622s1c1
Sequence:CCGGCGGAACACGATTGTCTCAGATCTCGAGATCTGAGACAATCGTGTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)