EMAIL THIS PAGE TO A FRIEND

MUM1L1

melanoma associated antigen (mutated) 1-like 1

165 Gene Product Result for
UniProtKB ID: Q5H9M0, D3DUX2, Q49AS5, Q8N2C0, Q96MT6
Gene ID:
Human(139221) Summary: This gene encodes a protein which contains a mutated melanoma-associated antigen 1 domain. Proteins which contain mutated antigens are expressed at high levels on certain types of cancers. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2011]
Mouse(245631) melanoma associated antigen (mutated) 1-like 1
Rat(501630) melanoma associated antigen (mutated) 1-like 1
Horse(100054863) melanoma associated antigen (mutated) 1-like 1
cow(539380) melanoma associated antigen (mutated) 1-like 1
dog(610246) melanoma associated antigen (mutated) 1-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152423 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152423 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152423 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175541 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175541 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175541 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU094561 MISSION® esiRNA esiRNA human MUM1L1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152423 Rosetta Predictions human pricing
NM_001109321 Rosetta Predictions rat pricing
NM_175541 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152423 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182332 predicted 1205
2 SASI_Hs01_00182333 predicted 1424
3 SASI_Hs01_00182335 predicted 1056
4 SASI_Hs02_00366155 predicted 1109
5 SASI_Hs02_00366156 predicted 1917
6 SASI_Hs01_00182336 predicted 952
7 SASI_Hs01_00182337 predicted 1892
8 SASI_Hs02_00366157 predicted 964
9 SASI_Hs01_00182338 predicted 1847
10 SASI_Hs01_00182339 predicted 495
11 SASI_Hs01_00182334 predicted 915
12 SASI_Hs01_00182340 predicted 1809
13 SASI_Hs01_00182341 predicted 1403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109321 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247274 predicted 2197
2 SASI_Rn02_00247275 predicted 426
3 SASI_Rn02_00247276 predicted 1779
4 SASI_Rn02_00247277 predicted 2046
5 SASI_Rn02_00247278 predicted 1869
6 SASI_Rn02_00247279 predicted 270
7 SASI_Rn02_00247280 predicted 244
8 SASI_Rn02_00247281 predicted 2062
9 SASI_Rn02_00247282 predicted 1890
10 SASI_Rn02_00247283 predicted 1688
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175541 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137374 predicted 1109
2 SASI_Mm01_00137375 predicted 1624
3 SASI_Mm01_00137376 predicted 1429
4 SASI_Mm01_00137377 predicted 1518
5 SASI_Mm01_00137378 predicted 1331
6 SASI_Mm01_00137379 predicted 341
7 SASI_Mm01_00137380 predicted 1004
8 SASI_Mm02_00346496 predicted 664
9 SASI_Mm01_00137381 predicted 1081
10 SASI_Mm01_00137382 predicted 1610
11 SASI_Mm01_00137383 predicted 1458
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152423
MUM1L1 MISSION shRNA Bacterial Glycerol Stock
melanoma associated antigen (mutated) 1-like 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152423.2-1560s1c1
Sequence:CCGGCGAAGAACTTCCACGCTTCATCTCGAGATGAAGCGTGGAAGTTCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152423.2-1155s1c1
Sequence:CCGGGTCACCTTTGTCATCAGATATCTCGAGATATCTGATGACAAAGGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152423.2-772s1c1
Sequence:CCGGGAGATCACTATGCTGTCTCAACTCGAGTTGAGACAGCATAGTGATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152423.4-2152s21c1
Sequence:CCGGACAAAGCCAGGGAGGATTATACTCGAGTATAATCCTCCCTGGCTTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134032    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152423.2-3611s1c1
Sequence:CCGGCCAGAATCTGAGAATTTGGAACTCGAGTTCCAAATTCTCAGATTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152423.2-2134s1c1
Sequence:CCGGGAGAACCATCTTCTGGCCATTCTCGAGAATGGCCAGAAGATGGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152423.2-2248s1c1
Sequence:CCGGCAGTTGGATGAAGTGGTGAAACTCGAGTTTCACCACTTCATCCAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152423.2-1595s1c1
Sequence:CCGGCACATCCGTTTGAAACAGGAACTCGAGTTCCTGTTTCAAACGGATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152423
MUM1L1 MISSION shRNA shRNA Plasmid DNA
melanoma associated antigen (mutated) 1-like 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152423.2-1560s1c1
Sequence:CCGGCGAAGAACTTCCACGCTTCATCTCGAGATGAAGCGTGGAAGTTCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152423.2-1155s1c1
Sequence:CCGGGTCACCTTTGTCATCAGATATCTCGAGATATCTGATGACAAAGGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152423.2-772s1c1
Sequence:CCGGGAGATCACTATGCTGTCTCAACTCGAGTTGAGACAGCATAGTGATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152423.4-2152s21c1
Sequence:CCGGACAAAGCCAGGGAGGATTATACTCGAGTATAATCCTCCCTGGCTTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134032    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152423.2-3611s1c1
Sequence:CCGGCCAGAATCTGAGAATTTGGAACTCGAGTTCCAAATTCTCAGATTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152423.2-2134s1c1
Sequence:CCGGGAGAACCATCTTCTGGCCATTCTCGAGAATGGCCAGAAGATGGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152423.2-2248s1c1
Sequence:CCGGCAGTTGGATGAAGTGGTGAAACTCGAGTTTCACCACTTCATCCAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152423.2-1595s1c1
Sequence:CCGGCACATCCGTTTGAAACAGGAACTCGAGTTCCTGTTTCAAACGGATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152423
MUM1L1 MISSION shRNA Lentiviral Transduction Particles
melanoma associated antigen (mutated) 1-like 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152423.2-1560s1c1
Sequence:CCGGCGAAGAACTTCCACGCTTCATCTCGAGATGAAGCGTGGAAGTTCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152423.2-1155s1c1
Sequence:CCGGGTCACCTTTGTCATCAGATATCTCGAGATATCTGATGACAAAGGTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152423.2-772s1c1
Sequence:CCGGGAGATCACTATGCTGTCTCAACTCGAGTTGAGACAGCATAGTGATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152423.4-2152s21c1
Sequence:CCGGACAAAGCCAGGGAGGATTATACTCGAGTATAATCCTCCCTGGCTTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134032    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152423.2-3611s1c1
Sequence:CCGGCCAGAATCTGAGAATTTGGAACTCGAGTTCCAAATTCTCAGATTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152423.2-2134s1c1
Sequence:CCGGGAGAACCATCTTCTGGCCATTCTCGAGAATGGCCAGAAGATGGTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152423.2-2248s1c1
Sequence:CCGGCAGTTGGATGAAGTGGTGAAACTCGAGTTTCACCACTTCATCCAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152423.2-1595s1c1
Sequence:CCGGCACATCCGTTTGAAACAGGAACTCGAGTTCCTGTTTCAAACGGATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175541
VALIDATED
MUM1L1 MISSION shRNA Bacterial Glycerol Stock
melanoma associated antigen (mutated) 1-like 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201839    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175541.2-2081s1c1
Sequence:CCGGGCGTCTTTGCTGTATAGGTAACTCGAGTTACCTATACAGCAAAGACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175541.2-345s1c1
Sequence:CCGGGATTGACATCTCGGCAATCATCTCGAGATGATTGCCGAGATGTCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242071    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175541.2-2231s21c1
Sequence:CCGGCTCTTAAGATAGCCAATTTATCTCGAGATAAATTGGCTATCTTAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175541.2-382s21c1
Sequence:CCGGCTCAAAGAAGAAAGCGAATATCTCGAGATATTCGCTTTCTTCTTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175541.2-195s21c1
Sequence:CCGGTGATTCCATGACCGATGATAACTCGAGTTATCATCGGTCATGGAATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190479    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175541.2-2685s1c1
Sequence:CCGGGCACTGTGTTTAGAGTCCTTTCTCGAGAAAGGACTCTAAACACAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175541.2-1144s1c1
Sequence:CCGGGGCTCGTTCTTTGAGTATTATCTCGAGATAATACTCAAAGAACGAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175541.2-1101s1c1
Sequence:CCGGGATTTGTGACTACCGAGTTAGCTCGAGCTAACTCGGTAGTCACAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175541.2-1757s21c1
Sequence:CCGGTACCAAACGAAGGCCATTAATCTCGAGATTAATGGCCTTCGTTTGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175541.2-1144s21c1
Sequence:CCGGGGCTCGTTCTTTGAGTATTATCTCGAGATAATACTCAAAGAACGAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175541
VALIDATED
MUM1L1 MISSION shRNA shRNA Plasmid DNA
melanoma associated antigen (mutated) 1-like 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201839    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175541.2-2081s1c1
Sequence:CCGGGCGTCTTTGCTGTATAGGTAACTCGAGTTACCTATACAGCAAAGACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175541.2-345s1c1
Sequence:CCGGGATTGACATCTCGGCAATCATCTCGAGATGATTGCCGAGATGTCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242071    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175541.2-2231s21c1
Sequence:CCGGCTCTTAAGATAGCCAATTTATCTCGAGATAAATTGGCTATCTTAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175541.2-382s21c1
Sequence:CCGGCTCAAAGAAGAAAGCGAATATCTCGAGATATTCGCTTTCTTCTTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175541.2-195s21c1
Sequence:CCGGTGATTCCATGACCGATGATAACTCGAGTTATCATCGGTCATGGAATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190479    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175541.2-2685s1c1
Sequence:CCGGGCACTGTGTTTAGAGTCCTTTCTCGAGAAAGGACTCTAAACACAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175541.2-1144s1c1
Sequence:CCGGGGCTCGTTCTTTGAGTATTATCTCGAGATAATACTCAAAGAACGAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175541.2-1101s1c1
Sequence:CCGGGATTTGTGACTACCGAGTTAGCTCGAGCTAACTCGGTAGTCACAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175541.2-1757s21c1
Sequence:CCGGTACCAAACGAAGGCCATTAATCTCGAGATTAATGGCCTTCGTTTGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175541.2-1144s21c1
Sequence:CCGGGGCTCGTTCTTTGAGTATTATCTCGAGATAATACTCAAAGAACGAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175541
VALIDATED
MUM1L1 MISSION shRNA Lentiviral Transduction Particles
melanoma associated antigen (mutated) 1-like 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201839    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175541.2-2081s1c1
Sequence:CCGGGCGTCTTTGCTGTATAGGTAACTCGAGTTACCTATACAGCAAAGACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175541.2-345s1c1
Sequence:CCGGGATTGACATCTCGGCAATCATCTCGAGATGATTGCCGAGATGTCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242071    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175541.2-2231s21c1
Sequence:CCGGCTCTTAAGATAGCCAATTTATCTCGAGATAAATTGGCTATCTTAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175541.2-382s21c1
Sequence:CCGGCTCAAAGAAGAAAGCGAATATCTCGAGATATTCGCTTTCTTCTTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175541.2-195s21c1
Sequence:CCGGTGATTCCATGACCGATGATAACTCGAGTTATCATCGGTCATGGAATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190479    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175541.2-2685s1c1
Sequence:CCGGGCACTGTGTTTAGAGTCCTTTCTCGAGAAAGGACTCTAAACACAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175541.2-1144s1c1
Sequence:CCGGGGCTCGTTCTTTGAGTATTATCTCGAGATAATACTCAAAGAACGAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175541.2-1101s1c1
Sequence:CCGGGATTTGTGACTACCGAGTTAGCTCGAGCTAACTCGGTAGTCACAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175541.2-1757s21c1
Sequence:CCGGTACCAAACGAAGGCCATTAATCTCGAGATTAATGGCCTTCGTTTGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175541.2-1144s21c1
Sequence:CCGGGGCTCGTTCTTTGAGTATTATCTCGAGATAATACTCAAAGAACGAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)