EMAIL THIS PAGE TO A FRIEND

MUS81

MUS81 structure-specific endonuclease subunit

103 Gene Product Result for
Synonyms: SLX3
UniProtKB ID: Q96NY9, Q9H7D9
Gene ID:
Mouse(71711) MUS81 endonuclease homolog (yeast)
Rat(293678) MUS81 structure-specific endonuclease subunit
Zebrafish(406839) MUS81 endonuclease homolog (yeast)
domestic cat(101100670) MUS81 endonuclease homolog (S. cerevisiae)
cow(528432) MUS81 endonuclease homolog (S. cerevisiae)
Horse(100051745) MUS81 endonuclease homolog (S. cerevisiae)
dog(476021) MUS81 endonuclease homolog (S. cerevisiae)
fruit fly(31044) CG3026 gene product from transcript CG3026-RA
Thale Cress(829211) crossover junction endonuclease MUS81
sheep(101110192) MUS81 endonuclease homolog (S. cerevisiae)
naked mole-rat(101711801) MUS81 structure-specific endonuclease
domestic guinea pig(100732562) MUS81 structure-specific endonuclease
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025128 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025128 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025128 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027877 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027877 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027877 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU020611 MISSION® esiRNA esiRNA human MUS81 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025128 Rosetta Predictions human pricing
NM_001025645 Rosetta Predictions rat pricing
NM_027877 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025128 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146003 predicted 1153
2 SASI_Hs01_00146004 predicted 1903
3 SASI_Hs01_00146005 predicted 1918
4 SASI_Hs01_00146006 predicted 528
5 SASI_Hs01_00146007 predicted 810
6 SASI_Hs01_00146008 predicted 2007
7 SASI_Hs01_00146009 predicted 1325
8 SASI_Hs01_00146010 predicted 1247
9 SASI_Hs02_00357836 predicted 401
10 SASI_Hs01_00146011 predicted 1897
11 SASI_Hs01_00146012 predicted 1447
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025645 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203219 predicted 977
2 SASI_Rn02_00203220 predicted 1235
3 SASI_Rn01_00033123 predicted 1159
4 SASI_Rn01_00033124 predicted 857
5 SASI_Rn01_00033125 predicted 311
6 SASI_Rn01_00033127 predicted 875
7 SASI_Rn01_00033128 predicted 909
8 SASI_Rn01_00033129 predicted 1444
9 SASI_Rn01_00033130 predicted 505
10 SASI_Rn01_00033131 predicted 513
11 SASI_Rn01_00033122 predicted 1471
12 SASI_Rn01_00033126 predicted 1108
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027877 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120585 predicted 1119
2 SASI_Mm01_00120586 predicted 1762
3 SASI_Mm01_00120587 predicted 585
4 SASI_Mm01_00120588 predicted 1058
5 SASI_Mm01_00120589 predicted 1620
6 SASI_Mm02_00332838 predicted 1358
7 SASI_Mm01_00120590 predicted 1455
8 SASI_Mm01_00120591 predicted 1014
9 SASI_Mm01_00120592 predicted 999
10 SASI_Mm01_00120593 predicted 513
11 SASI_Mm01_00120594 predicted 899
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025128
VALIDATED
MUS81 MISSION shRNA Bacterial Glycerol Stock
MUS81 structure-specific endonuclease subunit
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025128.4-807s21c1
Sequence:CCGGCCTAATGGTCACCACTTCTTACTCGAGTAAGAAGTGGTGACCATTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025128.3-1249s1c1
Sequence:CCGGGAGTTGGTACTGGATCACATTCTCGAGAATGTGATCCAGTACCAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_025128.3-390s1c1
Sequence:CCGGCACGCGCTTCGTATTTCAGAACTCGAGTTCTGAAATACGAAGCGCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025128.3-730s1c1
Sequence:CCGGCCTAATGGTCACCACTTCTTACTCGAGTAAGAAGTGGTGACCATTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025128.3-1447s1c1
Sequence:CCGGACTCAGGTCATTGATGGCTTTCTCGAGAAAGCCATCAATGACCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025128.3-1656s1c1
Sequence:CCGGCGCAGGAGCCATCAAGAATAACTCGAGTTATTCTTGATGGCTCCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025128.4-1905s21c1
Sequence:CCGGACACTGCTGAGCACCATTAAGCTCGAGCTTAATGGTGCTCAGCAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025128.4-1326s21c1
Sequence:CCGGGAGTTGGTACTGGATCACATTCTCGAGAATGTGATCCAGTACCAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025128.4-2092s21c1
Sequence:CCGGCAATTAGAATCTAAGTGTTTGCTCGAGCAAACACTTAGATTCTAATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025128.4-1733s21c1
Sequence:CCGGCGCAGGAGCCATCAAGAATAACTCGAGTTATTCTTGATGGCTCCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025128
VALIDATED
MUS81 MISSION shRNA shRNA Plasmid DNA
MUS81 structure-specific endonuclease subunit
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025128.4-807s21c1
Sequence:CCGGCCTAATGGTCACCACTTCTTACTCGAGTAAGAAGTGGTGACCATTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025128.3-1249s1c1
Sequence:CCGGGAGTTGGTACTGGATCACATTCTCGAGAATGTGATCCAGTACCAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_025128.3-390s1c1
Sequence:CCGGCACGCGCTTCGTATTTCAGAACTCGAGTTCTGAAATACGAAGCGCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025128.3-730s1c1
Sequence:CCGGCCTAATGGTCACCACTTCTTACTCGAGTAAGAAGTGGTGACCATTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025128.3-1447s1c1
Sequence:CCGGACTCAGGTCATTGATGGCTTTCTCGAGAAAGCCATCAATGACCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025128.3-1656s1c1
Sequence:CCGGCGCAGGAGCCATCAAGAATAACTCGAGTTATTCTTGATGGCTCCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025128.4-1905s21c1
Sequence:CCGGACACTGCTGAGCACCATTAAGCTCGAGCTTAATGGTGCTCAGCAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025128.4-1326s21c1
Sequence:CCGGGAGTTGGTACTGGATCACATTCTCGAGAATGTGATCCAGTACCAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025128.4-2092s21c1
Sequence:CCGGCAATTAGAATCTAAGTGTTTGCTCGAGCAAACACTTAGATTCTAATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025128.4-1733s21c1
Sequence:CCGGCGCAGGAGCCATCAAGAATAACTCGAGTTATTCTTGATGGCTCCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025128
VALIDATED
MUS81 MISSION shRNA Lentiviral Transduction Particles
MUS81 structure-specific endonuclease subunit
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025128.4-807s21c1
Sequence:CCGGCCTAATGGTCACCACTTCTTACTCGAGTAAGAAGTGGTGACCATTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025128.3-1249s1c1
Sequence:CCGGGAGTTGGTACTGGATCACATTCTCGAGAATGTGATCCAGTACCAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_025128.3-390s1c1
Sequence:CCGGCACGCGCTTCGTATTTCAGAACTCGAGTTCTGAAATACGAAGCGCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025128.3-730s1c1
Sequence:CCGGCCTAATGGTCACCACTTCTTACTCGAGTAAGAAGTGGTGACCATTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025128.3-1447s1c1
Sequence:CCGGACTCAGGTCATTGATGGCTTTCTCGAGAAAGCCATCAATGACCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025128.3-1656s1c1
Sequence:CCGGCGCAGGAGCCATCAAGAATAACTCGAGTTATTCTTGATGGCTCCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025128.4-1905s21c1
Sequence:CCGGACACTGCTGAGCACCATTAAGCTCGAGCTTAATGGTGCTCAGCAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025128.4-1326s21c1
Sequence:CCGGGAGTTGGTACTGGATCACATTCTCGAGAATGTGATCCAGTACCAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025128.4-2092s21c1
Sequence:CCGGCAATTAGAATCTAAGTGTTTGCTCGAGCAAACACTTAGATTCTAATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025128.4-1733s21c1
Sequence:CCGGCGCAGGAGCCATCAAGAATAACTCGAGTTATTCTTGATGGCTCCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027877
VALIDATED
MUS81 MISSION shRNA Bacterial Glycerol Stock
MUS81 structure-specific endonuclease subunit
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027877.3-1618s21c1
Sequence:CCGGCCAGTCTGTGCGAGAAGTATTCTCGAGAATACTTCTCGCACAGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027877.2-689s1c1
Sequence:CCGGCCACAGCTTCCTAACCAAAGACTCGAGTCTTTGGTTAGGAAGCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027877.3-735s21c1
Sequence:CCGGTAGTGCCTGGAAGTTCGAAACCTCGAGGTTTCGAACTTCCAGGCACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027877.3-1410s21c1
Sequence:CCGGTGAAGCGAACCATGGATATTACTCGAGTAATATCCATGGTTCGCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027877.2-1032s1c1
Sequence:CCGGGTGCTGTTGTGTGTGGACATTCTCGAGAATGTCCACACACAACAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027877.2-1586s1c1
Sequence:CCGGCCTCACCTTCAGTGACTTCAACTCGAGTTGAAGTCACTGAAGGTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027877.3-1411s1c1
Sequence:CCGGGAAGCGAACCATGGATATTAACTCGAGTTAATATCCATGGTTCGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027877.3-1230s21c1
Sequence:CCGGACCTATGCAGCAGCATCATTGCTCGAGCAATGATGCTGCTGCATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027877.3-1068s21c1
Sequence:CCGGCAGAAATGCTCCGAGAGTTACCTCGAGGTAACTCTCGGAGCATTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027877
VALIDATED
MUS81 MISSION shRNA shRNA Plasmid DNA
MUS81 structure-specific endonuclease subunit
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027877.3-1618s21c1
Sequence:CCGGCCAGTCTGTGCGAGAAGTATTCTCGAGAATACTTCTCGCACAGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027877.2-689s1c1
Sequence:CCGGCCACAGCTTCCTAACCAAAGACTCGAGTCTTTGGTTAGGAAGCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027877.3-735s21c1
Sequence:CCGGTAGTGCCTGGAAGTTCGAAACCTCGAGGTTTCGAACTTCCAGGCACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027877.3-1410s21c1
Sequence:CCGGTGAAGCGAACCATGGATATTACTCGAGTAATATCCATGGTTCGCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027877.2-1032s1c1
Sequence:CCGGGTGCTGTTGTGTGTGGACATTCTCGAGAATGTCCACACACAACAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027877.2-1586s1c1
Sequence:CCGGCCTCACCTTCAGTGACTTCAACTCGAGTTGAAGTCACTGAAGGTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027877.3-1411s1c1
Sequence:CCGGGAAGCGAACCATGGATATTAACTCGAGTTAATATCCATGGTTCGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027877.3-1230s21c1
Sequence:CCGGACCTATGCAGCAGCATCATTGCTCGAGCAATGATGCTGCTGCATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027877.3-1068s21c1
Sequence:CCGGCAGAAATGCTCCGAGAGTTACCTCGAGGTAACTCTCGGAGCATTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027877
VALIDATED
MUS81 MISSION shRNA Lentiviral Transduction Particles
MUS81 structure-specific endonuclease subunit
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027877.3-1618s21c1
Sequence:CCGGCCAGTCTGTGCGAGAAGTATTCTCGAGAATACTTCTCGCACAGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027877.2-689s1c1
Sequence:CCGGCCACAGCTTCCTAACCAAAGACTCGAGTCTTTGGTTAGGAAGCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027877.3-735s21c1
Sequence:CCGGTAGTGCCTGGAAGTTCGAAACCTCGAGGTTTCGAACTTCCAGGCACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027877.3-1410s21c1
Sequence:CCGGTGAAGCGAACCATGGATATTACTCGAGTAATATCCATGGTTCGCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027877.2-1032s1c1
Sequence:CCGGGTGCTGTTGTGTGTGGACATTCTCGAGAATGTCCACACACAACAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027877.2-1586s1c1
Sequence:CCGGCCTCACCTTCAGTGACTTCAACTCGAGTTGAAGTCACTGAAGGTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027877.3-1411s1c1
Sequence:CCGGGAAGCGAACCATGGATATTAACTCGAGTTAATATCCATGGTTCGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027877.3-1230s21c1
Sequence:CCGGACCTATGCAGCAGCATCATTGCTCGAGCAATGATGCTGCTGCATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027877.3-1068s21c1
Sequence:CCGGCAGAAATGCTCCGAGAGTTACCTCGAGGTAACTCTCGGAGCATTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)