EMAIL THIS PAGE TO A FRIEND

MUSK

muscle, skeletal, receptor tyrosine kinase

119 Gene Product Result for
UniProtKB ID: O15146, Q32MJ8, Q32MJ9, Q5VZW7, Q5VZW8
Gene ID:
Human(4593) Summary: This gene encodes a muscle-specific tyrosine kinase receptor. The encoded protein may play a role in clustering of the acetylcholine receptor in the postsynaptic neuromuscular junction. Mutations in this gene have been associated with congenital myasthenic syndrome. Alternatively spliced transcript variants have been described.[provided by RefSeq, Oct 2009]
Mouse(18198) muscle, skeletal, receptor tyrosine kinase
Rat(81725) muscle, skeletal, receptor tyrosine kinase
sheep(101112879) muscle, skeletal, receptor tyrosine kinase
domestic guinea pig(100729607) muscle, skeletal, receptor tyrosine kinase
naked mole-rat(101715083) muscle, skeletal, receptor tyrosine kinase
Zebrafish(334526) muscle, skeletal, receptor tyrosine kinase
cow(540052) muscle, skeletal, receptor tyrosine kinase
Horse(100058619) muscle, skeletal, receptor tyrosine kinase
domestic cat(101092154) muscle, skeletal, receptor tyrosine kinase
dog(481662) muscle, skeletal, receptor tyrosine kinase
chicken(373897) muscle, skeletal, receptor tyrosine kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010944 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010944 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010944 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005592 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005592 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005592 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU013701 MISSION® esiRNA esiRNA targeting human MUSK (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005592 Rosetta Predictions human pricing
NM_031061 Rosetta Predictions rat pricing
NM_001037127 Rosetta Predictions mouse pricing
NM_001037128 Rosetta Predictions mouse pricing
NM_001037129 Rosetta Predictions mouse pricing
NM_001037130 Rosetta Predictions mouse pricing
NM_010944 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005592 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339891 predicted 1563
2 SASI_Hs01_00125685 predicted 1157
3 SASI_Hs01_00125686 predicted 1273
4 SASI_Hs01_00125687 predicted 932
5 SASI_Hs01_00125688 predicted 1637
6 SASI_Hs01_00125689 predicted 585
7 SASI_Hs01_00125690 predicted 1000
8 SASI_Hs01_00125691 predicted 437
9 SASI_Hs01_00125692 predicted 512
10 SASI_Hs01_00125693 predicted 785
11 SASI_Hs01_00125684 predicted 2301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031061 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064462 predicted 981
2 SASI_Rn01_00064463 predicted 1302
3 SASI_Rn01_00064464 predicted 918
4 SASI_Rn01_00064465 predicted 945
5 SASI_Rn01_00064466 predicted 1451
6 SASI_Rn02_00264299 predicted 1027
7 SASI_Rn01_00064467 predicted 2100
8 SASI_Rn01_00064468 predicted 1835
9 SASI_Rn01_00064470 predicted 2517
10 SASI_Rn01_00064471 predicted 2386
11 SASI_Rn01_00064469 predicted 963
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037127 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140788 predicted 2360
2 SASI_Mm01_00140789 predicted 1342
3 SASI_Mm01_00140791 predicted 1947
4 SASI_Mm01_00140792 predicted 475
5 SASI_Mm01_00140793 predicted 2569
6 SASI_Mm01_00140794 predicted 2173
7 SASI_Mm02_00289278 predicted 2023
8 SASI_Mm01_00140796 predicted 2495
9 SASI_Mm01_00140797 predicted 1917
10 SASI_Mm02_00289279 predicted 2498
11 SASI_Mm01_00140790 predicted 2176
12 SASI_Mm01_00140795 predicted 498
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037128 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105061 predicted 2317
2 SASI_Mm01_00105062 predicted 1295
3 SASI_Mm01_00105064 predicted 1895
4 SASI_Mm01_00105065 predicted 477
5 SASI_Mm01_00105066 predicted 2525
6 SASI_Mm01_00105067 predicted 2131
7 SASI_Mm02_00289280 predicted 1978
8 SASI_Mm01_00105069 predicted 2451
9 SASI_Mm01_00105070 predicted 1875
10 SASI_Mm02_00289281 predicted 2449
11 SASI_Mm01_00105063 predicted 2128
12 SASI_Mm01_00105068 predicted 492
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037129 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063125 predicted 2296
2 SASI_Mm01_00063126 predicted 1296
3 SASI_Mm01_00063128 predicted 1877
4 SASI_Mm01_00063129 predicted 479
5 SASI_Mm01_00063130 predicted 2494
6 SASI_Mm01_00063131 predicted 2104
7 SASI_Mm02_00289282 predicted 1953
8 SASI_Mm01_00063133 predicted 2424
9 SASI_Mm01_00063134 predicted 1857
10 SASI_Mm02_00289283 predicted 2422
11 SASI_Mm01_00063127 predicted 2102
12 SASI_Mm01_00063132 predicted 491
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037130 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152051 predicted 2262
2 SASI_Mm01_00152052 predicted 1269
3 SASI_Mm01_00152054 predicted 1844
4 SASI_Mm01_00152055 predicted 470
5 SASI_Mm01_00152056 predicted 2471
6 SASI_Mm01_00152057 predicted 2076
7 SASI_Mm02_00289284 predicted 1923
8 SASI_Mm01_00152059 predicted 2395
9 SASI_Mm01_00152060 predicted 1823
10 SASI_Mm02_00289285 predicted 2399
11 SASI_Mm01_00152053 predicted 2078
12 SASI_Mm01_00152058 predicted 501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010944 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087658 predicted 2290
2 SASI_Mm01_00087659 predicted 1268
3 SASI_Mm01_00087661 predicted 1865
4 SASI_Mm01_00087662 predicted 470
5 SASI_Mm01_00087663 predicted 2489
6 SASI_Mm01_00087664 predicted 2104
7 SASI_Mm02_00319700 predicted 1944
8 SASI_Mm01_00087666 predicted 2423
9 SASI_Mm01_00087667 predicted 1849
10 SASI_Mm02_00319701 predicted 2421
11 SASI_Mm01_00087660 predicted 2093
12 SASI_Mm01_00087665 predicted 497
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010944
MUSK MISSION shRNA Bacterial Glycerol Stock
muscle, skeletal, receptor tyrosine kinase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010944.2-991s21c1
Sequence:CCGGACATGCATAGCTACCAATAAGCTCGAGCTTATTGGTAGCTATGCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010944.2-1528s21c1
Sequence:CCGGATAACAACATTCCCGTCAATACTCGAGTATTGACGGGAATGTTGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010944.2-1489s21c1
Sequence:CCGGTGCACAAGACTGCCATATTTACTCGAGTAAATATGGCAGTCTTGTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010944.1-1717s1c1
Sequence:CCGGCCGAGGAATAACATTGAGTATCTCGAGATACTCAATGTTATTCCTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010944.1-1912s1c1
Sequence:CCGGCCCAACATTGTGAAACTCTTACTCGAGTAAGAGTTTCACAATGTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010944.1-1346s1c1
Sequence:CCGGCCTGCACAAGACTGCCATATTCTCGAGAATATGGCAGTCTTGTGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010944.1-2316s1c1
Sequence:CCGGGCCCGAGTCTATCTTCTACAACTCGAGTTGTAGAAGATAGACTCGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010944.1-850s1c1
Sequence:CCGGGCTACCAATAAGCACGGAGAACTCGAGTTCTCCGTGCTTATTGGTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010944
MUSK MISSION shRNA shRNA Plasmid DNA
muscle, skeletal, receptor tyrosine kinase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010944.2-991s21c1
Sequence:CCGGACATGCATAGCTACCAATAAGCTCGAGCTTATTGGTAGCTATGCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010944.2-1528s21c1
Sequence:CCGGATAACAACATTCCCGTCAATACTCGAGTATTGACGGGAATGTTGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010944.2-1489s21c1
Sequence:CCGGTGCACAAGACTGCCATATTTACTCGAGTAAATATGGCAGTCTTGTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010944.1-1717s1c1
Sequence:CCGGCCGAGGAATAACATTGAGTATCTCGAGATACTCAATGTTATTCCTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010944.1-1912s1c1
Sequence:CCGGCCCAACATTGTGAAACTCTTACTCGAGTAAGAGTTTCACAATGTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010944.1-1346s1c1
Sequence:CCGGCCTGCACAAGACTGCCATATTCTCGAGAATATGGCAGTCTTGTGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010944.1-2316s1c1
Sequence:CCGGGCCCGAGTCTATCTTCTACAACTCGAGTTGTAGAAGATAGACTCGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010944.1-850s1c1
Sequence:CCGGGCTACCAATAAGCACGGAGAACTCGAGTTCTCCGTGCTTATTGGTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010944
MUSK MISSION shRNA Lentiviral Transduction Particles
muscle, skeletal, receptor tyrosine kinase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010944.2-991s21c1
Sequence:CCGGACATGCATAGCTACCAATAAGCTCGAGCTTATTGGTAGCTATGCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010944.2-1528s21c1
Sequence:CCGGATAACAACATTCCCGTCAATACTCGAGTATTGACGGGAATGTTGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010944.2-1489s21c1
Sequence:CCGGTGCACAAGACTGCCATATTTACTCGAGTAAATATGGCAGTCTTGTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010944.1-1717s1c1
Sequence:CCGGCCGAGGAATAACATTGAGTATCTCGAGATACTCAATGTTATTCCTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010944.1-1912s1c1
Sequence:CCGGCCCAACATTGTGAAACTCTTACTCGAGTAAGAGTTTCACAATGTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010944.1-1346s1c1
Sequence:CCGGCCTGCACAAGACTGCCATATTCTCGAGAATATGGCAGTCTTGTGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010944.1-2316s1c1
Sequence:CCGGGCCCGAGTCTATCTTCTACAACTCGAGTTGTAGAAGATAGACTCGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010944.1-850s1c1
Sequence:CCGGGCTACCAATAAGCACGGAGAACTCGAGTTCTCCGTGCTTATTGGTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005592
MUSK MISSION shRNA Bacterial Glycerol Stock
muscle, skeletal, receptor tyrosine kinase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005592.2-1444s21c1
Sequence:CCGGGACTGCCACATCTAGATTATACTCGAGTATAATCTAGATGTGGCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005592.2-939s21c1
Sequence:CCGGACATGCATAGCTACCAATAAGCTCGAGCTTATTGGTAGCTATGCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005592.2-2516s21c1
Sequence:CCGGGGCCCATGAGGAGGTCATTTACTCGAGTAAATGACCTCCTCATGGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005592.1-392s1c1
Sequence:CCGGCAAGTGAAGATGAAACCTAAACTCGAGTTTAGGTTTCATCTTCACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005592.x-1109s1c1
Sequence:CCGGGCCTGGAATGAACTGAAAGTACTCGAGTACTTTCAGTTCATTCCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005592.x-875s1c1
Sequence:CCGGCCAGGACTCTACACATGCATACTCGAGTATGCATGTGTAGAGTCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005592.x-2477s1c1
Sequence:CCGGGTCATTTACTACGTGCGAGATCTCGAGATCTCGCACGTAGTAAATGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005592.x-2303s1c1
Sequence:CCGGGCAGACTACTACAAAGCTAATCTCGAGATTAGCTTTGTAGTAGTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005592.x-2202s1c1
Sequence:CCGGGTAAGTTTGTTCACCGAGATTCTCGAGAATCTCGGTGAACAAACTTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005592
MUSK MISSION shRNA shRNA Plasmid DNA
muscle, skeletal, receptor tyrosine kinase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005592.2-1444s21c1
Sequence:CCGGGACTGCCACATCTAGATTATACTCGAGTATAATCTAGATGTGGCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005592.2-939s21c1
Sequence:CCGGACATGCATAGCTACCAATAAGCTCGAGCTTATTGGTAGCTATGCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005592.2-2516s21c1
Sequence:CCGGGGCCCATGAGGAGGTCATTTACTCGAGTAAATGACCTCCTCATGGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005592.1-392s1c1
Sequence:CCGGCAAGTGAAGATGAAACCTAAACTCGAGTTTAGGTTTCATCTTCACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005592.x-1109s1c1
Sequence:CCGGGCCTGGAATGAACTGAAAGTACTCGAGTACTTTCAGTTCATTCCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005592.x-875s1c1
Sequence:CCGGCCAGGACTCTACACATGCATACTCGAGTATGCATGTGTAGAGTCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005592.x-2477s1c1
Sequence:CCGGGTCATTTACTACGTGCGAGATCTCGAGATCTCGCACGTAGTAAATGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005592.x-2303s1c1
Sequence:CCGGGCAGACTACTACAAAGCTAATCTCGAGATTAGCTTTGTAGTAGTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005592.x-2202s1c1
Sequence:CCGGGTAAGTTTGTTCACCGAGATTCTCGAGAATCTCGGTGAACAAACTTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005592
MUSK MISSION shRNA Lentiviral Transduction Particles
muscle, skeletal, receptor tyrosine kinase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005592.2-1444s21c1
Sequence:CCGGGACTGCCACATCTAGATTATACTCGAGTATAATCTAGATGTGGCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005592.2-939s21c1
Sequence:CCGGACATGCATAGCTACCAATAAGCTCGAGCTTATTGGTAGCTATGCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005592.2-2516s21c1
Sequence:CCGGGGCCCATGAGGAGGTCATTTACTCGAGTAAATGACCTCCTCATGGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005592.1-392s1c1
Sequence:CCGGCAAGTGAAGATGAAACCTAAACTCGAGTTTAGGTTTCATCTTCACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005592.x-1109s1c1
Sequence:CCGGGCCTGGAATGAACTGAAAGTACTCGAGTACTTTCAGTTCATTCCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005592.x-875s1c1
Sequence:CCGGCCAGGACTCTACACATGCATACTCGAGTATGCATGTGTAGAGTCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005592.x-2477s1c1
Sequence:CCGGGTCATTTACTACGTGCGAGATCTCGAGATCTCGCACGTAGTAAATGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005592.x-2303s1c1
Sequence:CCGGGCAGACTACTACAAAGCTAATCTCGAGATTAGCTTTGTAGTAGTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005592.x-2202s1c1
Sequence:CCGGGTAAGTTTGTTCACCGAGATTCTCGAGAATCTCGGTGAACAAACTTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)