EMAIL THIS PAGE TO A FRIEND

MUSTN1

musculoskeletal, embryonic nuclear protein 1

50 Gene Product Result for
Synonyms: MUSTANG
UniProtKB ID: Q8IVN3
Gene ID:
Mouse(66175) musculoskeletal, embryonic nuclear protein 1
Rat(290553) musculoskeletal, embryonic nuclear protein 1
Zebrafish(563713) musculoskeletal, embryonic nuclear protein 1
chicken(404773) musculoskeletal, embryonic nuclear protein 1
cow(616088) musculoskeletal, embryonic nuclear protein 1
dog(607080) musculoskeletal, embryonic nuclear protein 1
sheep(101108693) musculoskeletal, embryonic nuclear protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1103857 Anti-MUSTN1 (6-20) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181390 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181390 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181390 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_205853 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_205853 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_205853 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_205853 Rosetta Predictions human pricing
NM_181368 Rosetta Predictions rat pricing
NM_181390 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_205853 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245652 predicted 349
2 SASI_Hs02_00373486 predicted 329
3 SASI_Hs02_00373487 predicted 328
4 SASI_Hs01_00245653 predicted 482
5 SASI_Hs01_00245654 predicted 369
6 SASI_Hs02_00373488 predicted 367
7 SASI_Hs02_00373489 predicted 326
8 SASI_Hs01_00245657 predicted 438
9 SASI_Hs01_00245658 predicted 385
10 SASI_Hs02_00373490 predicted 299
11 SASI_Hs01_00245655 predicted 301
12 SASI_Hs01_00245656 predicted 237
13 SASI_Hs01_00245659 predicted 328
14 SASI_Hs01_00245660 predicted 283
15 SASI_Hs01_00245661 predicted 295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181368 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080359 predicted 820
2 SASI_Rn01_00080360 predicted 821
3 SASI_Rn01_00080361 predicted 813
4 SASI_Rn01_00080362 predicted 823
5 SASI_Rn02_00269698 predicted 829
6 SASI_Rn01_00080364 predicted 817
7 SASI_Rn01_00080365 predicted 833
8 SASI_Rn01_00080366 predicted 779
9 SASI_Rn01_00080367 predicted 787
10 SASI_Rn01_00080368 predicted 806
11 SASI_Rn01_00080363 predicted 810
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181390 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166936 predicted 924
2 SASI_Mm02_00349728 predicted 423
3 SASI_Mm02_00349729 predicted 427
4 SASI_Mm01_00166939 predicted 910
5 SASI_Mm01_00166940 predicted 910
6 SASI_Mm02_00349730 predicted 425
7 SASI_Mm01_00166941 predicted 905
8 SASI_Mm01_00166943 predicted 882
9 SASI_Mm01_00166945 predicted 917
10 SASI_Mm02_00349731 predicted 926
11 SASI_Mm01_00166937 predicted 654
12 SASI_Mm01_00166938 predicted 665
13 SASI_Mm01_00166942 predicted 626
14 SASI_Mm01_00166944 predicted 659
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181390
VALIDATED
MUSTN1 MISSION shRNA Bacterial Glycerol Stock
musculoskeletal, embryonic nuclear protein 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181390.1-173s1c1
Sequence:CCGGCATCAAGTCTAAGACATACCACTCGAGTGGTATGTCTTAGACTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181390.1-168s1c1
Sequence:CCGGCAGGACATCAAGTCTAAGACACTCGAGTGTCTTAGACTTGATGTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_181390.1-179s1c1
Sequence:CCGGGTCTAAGACATACCAGGTCATCTCGAGATGACCTGGTATGTCTTAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_181390.1-268s1c1
Sequence:CCGGCAGTCTTTGAGAAGCCCAAAGCTCGAGCTTTGGGCTTCTCAAAGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181390.1-731s1c1
Sequence:CCGGGCCATTTCTTTAGAGGACTCTCTCGAGAGAGTCCTCTAAAGAAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174939    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_181390.1-674s1c1
Sequence:CCGGGTTCTTCCTAAATCTCTGTTTCTCGAGAAACAGAGATTTAGGAAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181390.3-723s21c1
Sequence:CCGGGCCCTTGGAAACACCAATAAACTCGAGTTTATTGGTGTTTCCAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216855    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181390.3-985s1c1
Sequence:CCGGGAAGATGGTGCCATAGCTAAACTCGAGTTTAGCTATGGCACCATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181390.3-461s21c1
Sequence:CCGGGTCTAAGACATACCAGGTCATCTCGAGATGACCTGGTATGTCTTAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181390.3-550s21c1
Sequence:CCGGCAGTCTTTGAGAAGCCCAAAGCTCGAGCTTTGGGCTTCTCAAAGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181390.3-450s21c1
Sequence:CCGGCAGGACATCAAGTCTAAGACACTCGAGTGTCTTAGACTTGATGTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181390
VALIDATED
MUSTN1 MISSION shRNA shRNA Plasmid DNA
musculoskeletal, embryonic nuclear protein 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181390.1-173s1c1
Sequence:CCGGCATCAAGTCTAAGACATACCACTCGAGTGGTATGTCTTAGACTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181390.1-168s1c1
Sequence:CCGGCAGGACATCAAGTCTAAGACACTCGAGTGTCTTAGACTTGATGTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_181390.1-179s1c1
Sequence:CCGGGTCTAAGACATACCAGGTCATCTCGAGATGACCTGGTATGTCTTAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_181390.1-268s1c1
Sequence:CCGGCAGTCTTTGAGAAGCCCAAAGCTCGAGCTTTGGGCTTCTCAAAGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181390.1-731s1c1
Sequence:CCGGGCCATTTCTTTAGAGGACTCTCTCGAGAGAGTCCTCTAAAGAAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174939    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_181390.1-674s1c1
Sequence:CCGGGTTCTTCCTAAATCTCTGTTTCTCGAGAAACAGAGATTTAGGAAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181390.3-723s21c1
Sequence:CCGGGCCCTTGGAAACACCAATAAACTCGAGTTTATTGGTGTTTCCAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216855    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181390.3-985s1c1
Sequence:CCGGGAAGATGGTGCCATAGCTAAACTCGAGTTTAGCTATGGCACCATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181390.3-461s21c1
Sequence:CCGGGTCTAAGACATACCAGGTCATCTCGAGATGACCTGGTATGTCTTAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181390.3-550s21c1
Sequence:CCGGCAGTCTTTGAGAAGCCCAAAGCTCGAGCTTTGGGCTTCTCAAAGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181390.3-450s21c1
Sequence:CCGGCAGGACATCAAGTCTAAGACACTCGAGTGTCTTAGACTTGATGTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181390
VALIDATED
MUSTN1 MISSION shRNA Lentiviral Transduction Particles
musculoskeletal, embryonic nuclear protein 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181390.1-173s1c1
Sequence:CCGGCATCAAGTCTAAGACATACCACTCGAGTGGTATGTCTTAGACTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181390.1-168s1c1
Sequence:CCGGCAGGACATCAAGTCTAAGACACTCGAGTGTCTTAGACTTGATGTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_181390.1-179s1c1
Sequence:CCGGGTCTAAGACATACCAGGTCATCTCGAGATGACCTGGTATGTCTTAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_181390.1-268s1c1
Sequence:CCGGCAGTCTTTGAGAAGCCCAAAGCTCGAGCTTTGGGCTTCTCAAAGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181390.1-731s1c1
Sequence:CCGGGCCATTTCTTTAGAGGACTCTCTCGAGAGAGTCCTCTAAAGAAATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174939    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_181390.1-674s1c1
Sequence:CCGGGTTCTTCCTAAATCTCTGTTTCTCGAGAAACAGAGATTTAGGAAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181390.3-723s21c1
Sequence:CCGGGCCCTTGGAAACACCAATAAACTCGAGTTTATTGGTGTTTCCAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216855    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181390.3-985s1c1
Sequence:CCGGGAAGATGGTGCCATAGCTAAACTCGAGTTTAGCTATGGCACCATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181390.3-461s21c1
Sequence:CCGGGTCTAAGACATACCAGGTCATCTCGAGATGACCTGGTATGTCTTAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181390.3-550s21c1
Sequence:CCGGCAGTCTTTGAGAAGCCCAAAGCTCGAGCTTTGGGCTTCTCAAAGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181390.3-450s21c1
Sequence:CCGGCAGGACATCAAGTCTAAGACACTCGAGTGTCTTAGACTTGATGTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_205853
MUSTN1 MISSION shRNA Bacterial Glycerol Stock
musculoskeletal, embryonic nuclear protein 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205853.2-334s21c1
Sequence:CCGGCCGAGGAAACCTGACCAAGAACTCGAGTTCTTGGTCAGGTTTCCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205853.2-342s21c1
Sequence:CCGGACCTGACCAAGAACCAGGAAACTCGAGTTTCCTGGTTCTTGGTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205853.2-362s21c1
Sequence:CCGGATCAAGTCCAAGACCTACCAGCTCGAGCTGGTAGGTCTTGGACTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205853.2-448s21c1
Sequence:CCGGTACCGAGACTGTCTTTGAGAACTCGAGTTCTCAAAGACAGTCTCGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205853.2-377s21c1
Sequence:CCGGTACCAGGTCATGCGAGAGTGTCTCGAGACACTCTCGCATGACCTGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_205853.2-550s21c1
Sequence:CCGGGAGCCTTTCCCAGGAACTCTTCTCGAGAAGAGTTCCTGGGAAAGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_205853
MUSTN1 MISSION shRNA shRNA Plasmid DNA
musculoskeletal, embryonic nuclear protein 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205853.2-334s21c1
Sequence:CCGGCCGAGGAAACCTGACCAAGAACTCGAGTTCTTGGTCAGGTTTCCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205853.2-342s21c1
Sequence:CCGGACCTGACCAAGAACCAGGAAACTCGAGTTTCCTGGTTCTTGGTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205853.2-362s21c1
Sequence:CCGGATCAAGTCCAAGACCTACCAGCTCGAGCTGGTAGGTCTTGGACTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205853.2-448s21c1
Sequence:CCGGTACCGAGACTGTCTTTGAGAACTCGAGTTCTCAAAGACAGTCTCGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205853.2-377s21c1
Sequence:CCGGTACCAGGTCATGCGAGAGTGTCTCGAGACACTCTCGCATGACCTGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_205853.2-550s21c1
Sequence:CCGGGAGCCTTTCCCAGGAACTCTTCTCGAGAAGAGTTCCTGGGAAAGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_205853
MUSTN1 MISSION shRNA Lentiviral Transduction Particles
musculoskeletal, embryonic nuclear protein 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205853.2-334s21c1
Sequence:CCGGCCGAGGAAACCTGACCAAGAACTCGAGTTCTTGGTCAGGTTTCCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205853.2-342s21c1
Sequence:CCGGACCTGACCAAGAACCAGGAAACTCGAGTTTCCTGGTTCTTGGTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205853.2-362s21c1
Sequence:CCGGATCAAGTCCAAGACCTACCAGCTCGAGCTGGTAGGTCTTGGACTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205853.2-448s21c1
Sequence:CCGGTACCGAGACTGTCTTTGAGAACTCGAGTTCTCAAAGACAGTCTCGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205853.2-377s21c1
Sequence:CCGGTACCAGGTCATGCGAGAGTGTCTCGAGACACTCTCGCATGACCTGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_205853.2-550s21c1
Sequence:CCGGGAGCCTTTCCCAGGAACTCTTCTCGAGAAGAGTTCCTGGGAAAGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)