EMAIL THIS PAGE TO A FRIEND

MUTYH

mutY homolog

112 Gene Product Result for
Synonyms: CYP2C MYH
Gene ID:
Human(4595) Summary: This gene encodes a DNA glycosylase involved in oxidative DNA damage repair. The enzyme excises adenine bases from the DNA backbone at sites where adenine is inappropriately paired with guanine, cytosine, or 8-oxo-7,8-dihydroguanine, a major oxidatively damaged DNA lesion. The protein is localized to the nucleus and mitochondria. Mutations in this gene result in heritable predisposition to colon and stomach cancer. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(70603) mutY homolog (E. coli)
Rat(170841) mutY homolog (E. coli)
Zebrafish(558403) mutY homolog (E. coli)
chicken(424594) mutY homolog (E. coli)
domestic cat(101089880) mutY homolog (E. coli)
cow(513051) mutY homolog (E. coli)
Horse(100052596) mutY homolog (E. coli)
dog(482515) mutY homolog (E. coli)
sheep(101119344) mutY homolog (E. coli)
naked mole-rat(101706875) mutY homolog (E. coli)
domestic guinea pig(100723877) mutY homolog (E. coli)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012222 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012222 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012222 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133250 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133250 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133250 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001048171 Rosetta Predictions human pricing
NM_001048172 Rosetta Predictions human pricing
NM_001048173 Rosetta Predictions human pricing
NM_001048174 Rosetta Predictions human pricing
NM_001128425 Rosetta Predictions human pricing
NM_012222 Rosetta Predictions human pricing
NM_133316 Rosetta Predictions rat pricing
NM_133250 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048171 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311552 predicted 1321
2 SASI_Hs02_00311553 predicted 595
3 SASI_Hs02_00311554 predicted 1624
4 SASI_Hs02_00311555 predicted 1504
5 SASI_Hs02_00311556 predicted 1113
6 SASI_Hs02_00311557 predicted 835
7 SASI_Hs02_00311558 predicted 1155
8 SASI_Hs02_00311559 predicted 911
9 SASI_Hs02_00311560 predicted 592
10 SASI_Hs02_00311561 predicted 830
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048172 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311562 predicted 1215
2 SASI_Hs02_00311563 predicted 486
3 SASI_Hs02_00311564 predicted 1512
4 SASI_Hs02_00311565 predicted 1401
5 SASI_Hs02_00311566 predicted 1007
6 SASI_Hs02_00311567 predicted 721
7 SASI_Hs02_00311568 predicted 1052
8 SASI_Hs02_00311569 predicted 805
9 SASI_Hs02_00311570 predicted 486
10 SASI_Hs02_00311571 predicted 721
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048173 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311572 predicted 1207
2 SASI_Hs02_00311573 predicted 482
3 SASI_Hs02_00311574 predicted 1512
4 SASI_Hs02_00311575 predicted 1399
5 SASI_Hs02_00311576 predicted 1000
6 SASI_Hs02_00311577 predicted 722
7 SASI_Hs02_00311578 predicted 1048
8 SASI_Hs02_00311579 predicted 801
9 SASI_Hs02_00311580 predicted 482
10 SASI_Hs02_00311581 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048174 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311582 predicted 1134
2 SASI_Hs02_00311583 predicted 403
3 SASI_Hs02_00311584 predicted 1431
4 SASI_Hs02_00311585 predicted 1318
5 SASI_Hs02_00311586 predicted 923
6 SASI_Hs02_00311587 predicted 641
7 SASI_Hs02_00311588 predicted 962
8 SASI_Hs02_00311589 predicted 717
9 SASI_Hs02_00311590 predicted 404
10 SASI_Hs02_00311591 predicted 644
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128425 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331136 predicted 447
2 SASI_Hs02_00331137 predicted 1363
3 SASI_Hs02_00331138 predicted 1556
4 SASI_Hs02_00331139 predicted 636
5 SASI_Hs02_00331140 predicted 1661
6 SASI_Hs02_00331141 predicted 1549
7 SASI_Hs02_00331142 predicted 425
8 SASI_Hs02_00331143 predicted 453
9 SASI_Hs02_00331144 predicted 1157
10 SASI_Hs02_00331145 predicted 517
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012222 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147364 predicted 1360
2 SASI_Hs02_00343891 predicted 634
3 SASI_Hs01_00147367 predicted 1650
4 SASI_Hs01_00147368 predicted 1542
5 SASI_Hs01_00147371 predicted 1143
6 SASI_Hs02_00343892 predicted 870
7 SASI_Hs02_00343893 predicted 1191
8 SASI_Hs02_00343894 predicted 948
9 SASI_Hs02_00343895 predicted 627
10 SASI_Hs02_00343896 predicted 862
11 SASI_Hs01_00147362 predicted 364
12 SASI_Hs01_00147363 predicted 288
13 SASI_Hs01_00147365 predicted 1478
14 SASI_Hs01_00147366 predicted 542
15 SASI_Hs01_00147369 predicted 339
16 SASI_Hs01_00147370 predicted 365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133316 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052340 predicted 1124
2 SASI_Rn01_00052341 predicted 1364
3 SASI_Rn01_00052342 predicted 630
4 SASI_Rn01_00052343 predicted 852
5 SASI_Rn01_00052344 predicted 320
6 SASI_Rn01_00052345 predicted 418
7 SASI_Rn01_00052346 predicted 528
8 SASI_Rn02_00267624 predicted 233
9 SASI_Rn01_00052347 predicted 336
10 SASI_Rn01_00052348 predicted 1311
11 SASI_Rn01_00052339 predicted 245
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133250 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052545 predicted 885
2 SASI_Mm01_00052546 predicted 477
3 SASI_Mm02_00338504 predicted 892
4 SASI_Mm01_00052547 predicted 200
5 SASI_Mm01_00052548 predicted 1272
6 SASI_Mm01_00052549 predicted 332
7 SASI_Mm01_00052550 predicted 244
8 SASI_Mm01_00052551 predicted 364
9 SASI_Mm01_00052552 predicted 810
10 SASI_Mm01_00052553 predicted 1255
11 SASI_Mm01_00052554 predicted 903
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012222
VALIDATED
MUTYH MISSION shRNA Bacterial Glycerol Stock
mutY homolog
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_012222.1-1472s1c1
Sequence:CCGGCAAGCTGACATATCAAGTATACTCGAGTATACTTGATATGTCAGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_012222.1-1704s1c1
Sequence:CCGGCAAGTCCTGGATAATTTCTTTCTCGAGAAAGAAATTATCCAGGACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_012222.1-429s1c1
Sequence:CCGGAGCTGGTACGACCAAGAGAAACTCGAGTTTCTCTTGGTCGTACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A3
TRC Version: 1 Clone ID:NM_012222.1-553s1c1
Sequence:CCGGCCACTGTGATCAACTACTATACTCGAGTATAGTAGTTGATCACAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012222.2-872s21c1
Sequence:CCGGCCATTGCCTCTATCGCCTTTGCTCGAGCAAAGGCGATAGAGGCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012222.2-511s21c1
Sequence:CCGGAGCTGGTACGACCAAGAGAAACTCGAGTTTCTCTTGGTCGTACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012222.2-635s21c1
Sequence:CCGGCCACTGTGATCAACTACTATACTCGAGTATAGTAGTTGATCACAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012222.2-1546s21c1
Sequence:CCGGTCTCACATCAAGCTGACATATCTCGAGATATGTCAGCTTGATGTGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012222.2-447s21c1
Sequence:CCGGTGTCTCCTCATACCATCTATTCTCGAGAATAGATGGTATGAGGAGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012222
VALIDATED
MUTYH MISSION shRNA shRNA Plasmid DNA
mutY homolog
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_012222.1-1472s1c1
Sequence:CCGGCAAGCTGACATATCAAGTATACTCGAGTATACTTGATATGTCAGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_012222.1-1704s1c1
Sequence:CCGGCAAGTCCTGGATAATTTCTTTCTCGAGAAAGAAATTATCCAGGACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_012222.1-429s1c1
Sequence:CCGGAGCTGGTACGACCAAGAGAAACTCGAGTTTCTCTTGGTCGTACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A3
TRC Version: 1 Clone ID:NM_012222.1-553s1c1
Sequence:CCGGCCACTGTGATCAACTACTATACTCGAGTATAGTAGTTGATCACAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012222.2-872s21c1
Sequence:CCGGCCATTGCCTCTATCGCCTTTGCTCGAGCAAAGGCGATAGAGGCAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012222.2-511s21c1
Sequence:CCGGAGCTGGTACGACCAAGAGAAACTCGAGTTTCTCTTGGTCGTACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012222.2-635s21c1
Sequence:CCGGCCACTGTGATCAACTACTATACTCGAGTATAGTAGTTGATCACAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012222.2-1546s21c1
Sequence:CCGGTCTCACATCAAGCTGACATATCTCGAGATATGTCAGCTTGATGTGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012222.2-447s21c1
Sequence:CCGGTGTCTCCTCATACCATCTATTCTCGAGAATAGATGGTATGAGGAGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012222
VALIDATED
MUTYH MISSION shRNA Lentiviral Transduction Particles
mutY homolog
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_012222.1-1472s1c1
Sequence:CCGGCAAGCTGACATATCAAGTATACTCGAGTATACTTGATATGTCAGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_012222.1-1704s1c1
Sequence:CCGGCAAGTCCTGGATAATTTCTTTCTCGAGAAAGAAATTATCCAGGACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_012222.1-429s1c1
Sequence:CCGGAGCTGGTACGACCAAGAGAAACTCGAGTTTCTCTTGGTCGTACCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A3
TRC Version: 1 Clone ID:NM_012222.1-553s1c1
Sequence:CCGGCCACTGTGATCAACTACTATACTCGAGTATAGTAGTTGATCACAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012222.2-872s21c1
Sequence:CCGGCCATTGCCTCTATCGCCTTTGCTCGAGCAAAGGCGATAGAGGCAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012222.2-511s21c1
Sequence:CCGGAGCTGGTACGACCAAGAGAAACTCGAGTTTCTCTTGGTCGTACCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012222.2-635s21c1
Sequence:CCGGCCACTGTGATCAACTACTATACTCGAGTATAGTAGTTGATCACAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012222.2-1546s21c1
Sequence:CCGGTCTCACATCAAGCTGACATATCTCGAGATATGTCAGCTTGATGTGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012222.2-447s21c1
Sequence:CCGGTGTCTCCTCATACCATCTATTCTCGAGAATAGATGGTATGAGGAGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133250
MUTYH MISSION shRNA Bacterial Glycerol Stock
mutY homolog
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133250.1-888s1c1
Sequence:CCGGCATAGAGGAGTGTGCTCTCAACTCGAGTTGAGAGCACACTCCTCTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133250.1-1270s1c1
Sequence:CCGGGTATACAGTCTGGCTCTAGATCTCGAGATCTAGAGCCAGACTGTATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133250.1-468s1c1
Sequence:CCGGGCTACAAGAAGGAGCTAGGAACTCGAGTTCCTAGCTCCTTCTTGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133250.1-578s21c1
Sequence:CCGGCCATTGCTTCCATCGCCTTTGCTCGAGCAAAGGCGATGGAAGCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217302    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133250.1-340s1c1
Sequence:CCGGGCCACAGTGATCGACTATTATCTCGAGATAATAGTCGATCACTGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133250.1-1254s21c1
Sequence:CCGGCAAACTGACGTATCAAGTATACTCGAGTATACTTGATACGTCAGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133250.1-338s21c1
Sequence:CCGGTTGCCACAGTGATCGACTATTCTCGAGAATAGTCGATCACTGTGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133250.1-1142s21c1
Sequence:CCGGCAGAACAGCATCAGCACAAAGCTCGAGCTTTGTGCTGATGCTGTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133250.1-301s21c1
Sequence:CCGGGTGTGGGTGTCAGAGGTTATGCTCGAGCATAACCTCTGACACCCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133250
MUTYH MISSION shRNA shRNA Plasmid DNA
mutY homolog
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133250.1-888s1c1
Sequence:CCGGCATAGAGGAGTGTGCTCTCAACTCGAGTTGAGAGCACACTCCTCTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133250.1-1270s1c1
Sequence:CCGGGTATACAGTCTGGCTCTAGATCTCGAGATCTAGAGCCAGACTGTATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133250.1-468s1c1
Sequence:CCGGGCTACAAGAAGGAGCTAGGAACTCGAGTTCCTAGCTCCTTCTTGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133250.1-578s21c1
Sequence:CCGGCCATTGCTTCCATCGCCTTTGCTCGAGCAAAGGCGATGGAAGCAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217302    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133250.1-340s1c1
Sequence:CCGGGCCACAGTGATCGACTATTATCTCGAGATAATAGTCGATCACTGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133250.1-1254s21c1
Sequence:CCGGCAAACTGACGTATCAAGTATACTCGAGTATACTTGATACGTCAGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133250.1-338s21c1
Sequence:CCGGTTGCCACAGTGATCGACTATTCTCGAGAATAGTCGATCACTGTGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133250.1-1142s21c1
Sequence:CCGGCAGAACAGCATCAGCACAAAGCTCGAGCTTTGTGCTGATGCTGTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133250.1-301s21c1
Sequence:CCGGGTGTGGGTGTCAGAGGTTATGCTCGAGCATAACCTCTGACACCCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133250
MUTYH MISSION shRNA Lentiviral Transduction Particles
mutY homolog
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133250.1-888s1c1
Sequence:CCGGCATAGAGGAGTGTGCTCTCAACTCGAGTTGAGAGCACACTCCTCTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133250.1-1270s1c1
Sequence:CCGGGTATACAGTCTGGCTCTAGATCTCGAGATCTAGAGCCAGACTGTATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133250.1-468s1c1
Sequence:CCGGGCTACAAGAAGGAGCTAGGAACTCGAGTTCCTAGCTCCTTCTTGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133250.1-578s21c1
Sequence:CCGGCCATTGCTTCCATCGCCTTTGCTCGAGCAAAGGCGATGGAAGCAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217302    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133250.1-340s1c1
Sequence:CCGGGCCACAGTGATCGACTATTATCTCGAGATAATAGTCGATCACTGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133250.1-1254s21c1
Sequence:CCGGCAAACTGACGTATCAAGTATACTCGAGTATACTTGATACGTCAGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133250.1-338s21c1
Sequence:CCGGTTGCCACAGTGATCGACTATTCTCGAGAATAGTCGATCACTGTGGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133250.1-1142s21c1
Sequence:CCGGCAGAACAGCATCAGCACAAAGCTCGAGCTTTGTGCTGATGCTGTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133250.1-301s21c1
Sequence:CCGGGTGTGGGTGTCAGAGGTTATGCTCGAGCATAACCTCTGACACCCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)