EMAIL THIS PAGE TO A FRIEND

MVB12A

multivesicular body subunit 12A

49 Gene Product Result for
Synonyms: CFBP FAM125A
UniProtKB ID: Q96EY5, Q96I18
Gene ID:
Mouse(73711) multivesicular body subunit 12A
Rat(290635) multivesicular body subunit 12A
cow(507199) family with sequence similarity 125, member A
domestic guinea pig(100733012) multivesicular body subunit 12A
naked mole-rat(101715946) multivesicular body subunit 12A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028617 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028617 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028617 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138401 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138401 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138401 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138401 Rosetta Predictions human pricing
NM_199375 Rosetta Predictions rat pricing
NM_028617 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138401 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363544 predicted 450
2 SASI_Hs01_00135904 predicted 229
3 SASI_Hs01_00135905 predicted 410
4 SASI_Hs01_00135906 predicted 414
5 SASI_Hs01_00135907 predicted 448
6 SASI_Hs01_00135908 predicted 380
7 SASI_Hs01_00135909 predicted 236
8 SASI_Hs01_00135910 predicted 222
9 SASI_Hs01_00135911 predicted 249
10 SASI_Hs01_00135913 predicted 758
11 SASI_Hs01_00135912 predicted 708
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199375 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115734 predicted 717
2 SASI_Rn01_00115736 predicted 691
3 SASI_Rn01_00115737 predicted 231
4 SASI_Rn01_00115738 predicted 541
5 SASI_Rn01_00115739 predicted 422
6 SASI_Rn01_00115740 predicted 781
7 SASI_Rn01_00115741 predicted 217
8 SASI_Rn01_00115742 predicted 660
9 SASI_Rn02_00270183 predicted 628
10 SASI_Rn01_00115743 predicted 764
11 SASI_Rn01_00115735 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028617 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182680 predicted 219
2 SASI_Mm01_00182681 predicted 344
3 SASI_Mm01_00182683 predicted 234
4 SASI_Mm01_00182684 predicted 220
5 SASI_Mm01_00182685 predicted 649
6 SASI_Mm01_00182686 predicted 651
7 SASI_Mm01_00182687 predicted 386
8 SASI_Mm01_00182688 predicted 775
9 SASI_Mm01_00182689 predicted 732
10 SASI_Mm02_00334112 predicted 390
11 SASI_Mm01_00182682 predicted 352
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028617
VALIDATED
MVB12A MISSION shRNA Bacterial Glycerol Stock
multivesicular body subunit 12A
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028617.2-782s21c1
Sequence:CCGGAGACATTGAGAAGGAGTATAACTCGAGTTATACTCCTTCTCAATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264306    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028617.2-893s21c1
Sequence:CCGGCCTTGCAGATACTGCTGATTGCTCGAGCAATCAGCAGTATCTGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028617.2-656s21c1
Sequence:CCGGATCCAGTCTCTATGGCATATCCTCGAGGATATGCCATAGAGACTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028617.2-464s21c1
Sequence:CCGGCTTTGCCATCTGGTGCAAGAACTCGAGTTCTTGCACCAGATGGCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028617.2-302s21c1
Sequence:CCGGAGTCAACGACCCTCAGGATATCTCGAGATATCCTGAGGGTCGTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028617.2-791s1c1
Sequence:CCGGGAAGGAGTATAACTATGGCTTCTCGAGAAGCCATAGTTATACTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028617.2-647s1c1
Sequence:CCGGCTATGAGGCATCCAGTCTCTACTCGAGTAGAGACTGGATGCCTCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028617
VALIDATED
MVB12A MISSION shRNA shRNA Plasmid DNA
multivesicular body subunit 12A
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028617.2-782s21c1
Sequence:CCGGAGACATTGAGAAGGAGTATAACTCGAGTTATACTCCTTCTCAATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264306    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028617.2-893s21c1
Sequence:CCGGCCTTGCAGATACTGCTGATTGCTCGAGCAATCAGCAGTATCTGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028617.2-656s21c1
Sequence:CCGGATCCAGTCTCTATGGCATATCCTCGAGGATATGCCATAGAGACTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028617.2-464s21c1
Sequence:CCGGCTTTGCCATCTGGTGCAAGAACTCGAGTTCTTGCACCAGATGGCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028617.2-302s21c1
Sequence:CCGGAGTCAACGACCCTCAGGATATCTCGAGATATCCTGAGGGTCGTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028617.2-791s1c1
Sequence:CCGGGAAGGAGTATAACTATGGCTTCTCGAGAAGCCATAGTTATACTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028617.2-647s1c1
Sequence:CCGGCTATGAGGCATCCAGTCTCTACTCGAGTAGAGACTGGATGCCTCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028617
VALIDATED
MVB12A MISSION shRNA Lentiviral Transduction Particles
multivesicular body subunit 12A
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028617.2-782s21c1
Sequence:CCGGAGACATTGAGAAGGAGTATAACTCGAGTTATACTCCTTCTCAATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264306    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028617.2-893s21c1
Sequence:CCGGCCTTGCAGATACTGCTGATTGCTCGAGCAATCAGCAGTATCTGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028617.2-656s21c1
Sequence:CCGGATCCAGTCTCTATGGCATATCCTCGAGGATATGCCATAGAGACTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028617.2-464s21c1
Sequence:CCGGCTTTGCCATCTGGTGCAAGAACTCGAGTTCTTGCACCAGATGGCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028617.2-302s21c1
Sequence:CCGGAGTCAACGACCCTCAGGATATCTCGAGATATCCTGAGGGTCGTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028617.2-791s1c1
Sequence:CCGGGAAGGAGTATAACTATGGCTTCTCGAGAAGCCATAGTTATACTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028617.2-647s1c1
Sequence:CCGGCTATGAGGCATCCAGTCTCTACTCGAGTAGAGACTGGATGCCTCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138401
VALIDATED
MVB12A MISSION shRNA Bacterial Glycerol Stock
multivesicular body subunit 12A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000162311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138401.1-789s1c1
Sequence:CCGGCATTGAGGAGGAGTATAACTACTCGAGTAGTTATACTCCTCCTCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138401.1-194s1c1
Sequence:CCGGGCTACTTCCTGTGCCTTAGTTCTCGAGAACTAAGGCACAGGAAGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165374    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138401.2-975s1c1
Sequence:CCGGGCAAGGCGTTTGCTATCTTCACTCGAGTGAAGATAGCAAACGCCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138401.1-195s1c1
Sequence:CCGGCTACTTCCTGTGCCTTAGTTCCTCGAGGAACTAAGGCACAGGAAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138401.1-348s1c1
Sequence:CCGGGAAACGCATGTGTGTGAAGCTCTCGAGAGCTTCACACACATGCGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138401.2-174s1c1
Sequence:CCGGGCAGAAATCTGGCTACTTCCTCTCGAGAGGAAGTAGCCAGATTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138401.1-468s1c1
Sequence:CCGGCTTTGCCATCTGGTGCAAGAACTCGAGTTCTTGCACCAGATGGCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138401.1-785s1c1
Sequence:CCGGCGGACATTGAGGAGGAGTATACTCGAGTATACTCCTCCTCAATGTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164851    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138401.2-981s1c1
Sequence:CCGGCGTTTGCTATCTTCAGCCACTCTCGAGAGTGGCTGAAGATAGCAAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138401.1-331s1c1
Sequence:CCGGGCCTCTGTGTCCAAGAAGAAACTCGAGTTTCTTCTTGGACACAGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138401
VALIDATED
MVB12A MISSION shRNA shRNA Plasmid DNA
multivesicular body subunit 12A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000162311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138401.1-789s1c1
Sequence:CCGGCATTGAGGAGGAGTATAACTACTCGAGTAGTTATACTCCTCCTCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138401.1-194s1c1
Sequence:CCGGGCTACTTCCTGTGCCTTAGTTCTCGAGAACTAAGGCACAGGAAGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165374    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138401.2-975s1c1
Sequence:CCGGGCAAGGCGTTTGCTATCTTCACTCGAGTGAAGATAGCAAACGCCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138401.1-195s1c1
Sequence:CCGGCTACTTCCTGTGCCTTAGTTCCTCGAGGAACTAAGGCACAGGAAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138401.1-348s1c1
Sequence:CCGGGAAACGCATGTGTGTGAAGCTCTCGAGAGCTTCACACACATGCGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138401.2-174s1c1
Sequence:CCGGGCAGAAATCTGGCTACTTCCTCTCGAGAGGAAGTAGCCAGATTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138401.1-468s1c1
Sequence:CCGGCTTTGCCATCTGGTGCAAGAACTCGAGTTCTTGCACCAGATGGCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138401.1-785s1c1
Sequence:CCGGCGGACATTGAGGAGGAGTATACTCGAGTATACTCCTCCTCAATGTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164851    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138401.2-981s1c1
Sequence:CCGGCGTTTGCTATCTTCAGCCACTCTCGAGAGTGGCTGAAGATAGCAAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138401.1-331s1c1
Sequence:CCGGGCCTCTGTGTCCAAGAAGAAACTCGAGTTTCTTCTTGGACACAGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138401
VALIDATED
MVB12A MISSION shRNA Lentiviral Transduction Particles
multivesicular body subunit 12A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000162311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138401.1-789s1c1
Sequence:CCGGCATTGAGGAGGAGTATAACTACTCGAGTAGTTATACTCCTCCTCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138401.1-194s1c1
Sequence:CCGGGCTACTTCCTGTGCCTTAGTTCTCGAGAACTAAGGCACAGGAAGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165374    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138401.2-975s1c1
Sequence:CCGGGCAAGGCGTTTGCTATCTTCACTCGAGTGAAGATAGCAAACGCCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138401.1-195s1c1
Sequence:CCGGCTACTTCCTGTGCCTTAGTTCCTCGAGGAACTAAGGCACAGGAAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138401.1-348s1c1
Sequence:CCGGGAAACGCATGTGTGTGAAGCTCTCGAGAGCTTCACACACATGCGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138401.2-174s1c1
Sequence:CCGGGCAGAAATCTGGCTACTTCCTCTCGAGAGGAAGTAGCCAGATTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138401.1-468s1c1
Sequence:CCGGCTTTGCCATCTGGTGCAAGAACTCGAGTTCTTGCACCAGATGGCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138401.1-785s1c1
Sequence:CCGGCGGACATTGAGGAGGAGTATACTCGAGTATACTCCTCCTCAATGTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164851    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138401.2-981s1c1
Sequence:CCGGCGTTTGCTATCTTCAGCCACTCTCGAGAGTGGCTGAAGATAGCAAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138401.1-331s1c1
Sequence:CCGGGCCTCTGTGTCCAAGAAGAAACTCGAGTTTCTTCTTGGACACAGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)