EMAIL THIS PAGE TO A FRIEND

MVB12B

multivesicular body subunit 12B

95 Gene Product Result for
Synonyms: C9orf28 FAM125B
UniProtKB ID: Q9H7P6, Q8N6S7
Gene ID:
Human(89853) Summary: The protein encoded by this gene is a component of the ESCRT-I complex, a heterotetramer, which mediates the sorting of ubiquitinated cargo protein from the plasma membrane to the endosomal vesicle. ESCRT-I complex plays an essential role in HIV budding and endosomal protein sorting. Depletion and overexpression of this and related protein (MVB12A) inhibit HIV-1 infectivity and induce unusual viral assembly defects, indicating a role for MVB12 subunits in regulating ESCRT-mediated virus budding. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Mouse(72543) multivesicular body subunit 12B
Rat(362118) multivesicular body subunit 12B
naked mole-rat(101707948) multivesicular body subunit 12B
domestic guinea pig(100728526) multivesicular body subunit 12B
cow(617416) multivesicular body subunit 12B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033446 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033446 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033446 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175184 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175184 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175184 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU061781 MISSION® esiRNA esiRNA human FAM125B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001011703 Rosetta Predictions human pricing
NM_033446 Rosetta Predictions human pricing
XM_001080165 Rosetta Predictions rat pricing
XM_342420 Rosetta Predictions rat pricing
NM_175184 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011703 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238055 predicted 355
2 SASI_Hs01_00238056 predicted 506
3 SASI_Hs01_00238057 predicted 506
4 SASI_Hs01_00238059 predicted 357
5 SASI_Hs01_00238060 predicted 472
6 SASI_Hs01_00238061 predicted 443
7 SASI_Hs01_00238062 predicted 522
8 SASI_Hs01_00238058 predicted 409
9 SASI_Hs01_00238063 predicted 399
10 SASI_Hs01_00238064 predicted 663
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033446 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167707 predicted 353
2 SASI_Hs01_00167708 predicted 505
3 SASI_Hs01_00167709 predicted 505
4 SASI_Hs01_00167711 predicted 358
5 SASI_Hs01_00167712 predicted 471
6 SASI_Hs01_00167713 predicted 437
7 SASI_Hs01_00167714 predicted 523
8 SASI_Hs01_00167710 predicted 417
9 SASI_Hs01_00167715 predicted 405
10 SASI_Hs02_00361336 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080165 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00366884 predicted 403
2 SASI_Rn02_00366885 predicted 356
3 SASI_Rn02_00366886 predicted 633
4 SASI_Rn02_00366887 predicted 669
5 SASI_Rn02_00366888 predicted 287
6 SASI_Rn02_00366889 predicted 364
7 SASI_Rn02_00366890 predicted 507
8 SASI_Rn02_00366891 predicted 666
9 SASI_Rn02_00366892 predicted 674
10 SASI_Rn02_00366893 predicted 401
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342420 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394239 predicted 1263
2 SASI_Rn02_00394240 predicted 1266
3 SASI_Rn02_00394241 predicted 1264
4 SASI_Rn02_00394242 predicted 1359
5 SASI_Rn02_00394243 predicted 1306
6 SASI_Rn02_00394244 predicted 1384
7 SASI_Rn02_00394245 predicted 1367
8 SASI_Rn02_00394246 predicted 1388
9 SASI_Rn02_00394247 predicted 1315
10 SASI_Rn02_00394248 predicted 1380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175184 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192326 predicted 1380
2 SASI_Mm01_00192327 predicted 968
3 SASI_Mm01_00192328 predicted 816
4 SASI_Mm01_00192329 predicted 1354
5 SASI_Mm01_00192330 predicted 1281
6 SASI_Mm01_00192331 predicted 968
7 SASI_Mm02_00345845 predicted 904
8 SASI_Mm01_00192332 predicted 1859
9 SASI_Mm01_00192333 predicted 1237
10 SASI_Mm01_00192335 predicted 1195
11 SASI_Mm01_00192334 predicted 1394
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033446
VALIDATED
MVB12B MISSION shRNA Bacterial Glycerol Stock
multivesicular body subunit 12B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033446.1-650s1c1
Sequence:CCGGGAATGGGCAGAGTACCAAGAACTCGAGTTCTTGGTACTCTGCCCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_033446.1-550s1c1
Sequence:CCGGGAAGCTGCGATTTGTGACATTCTCGAGAATGTCACAAATCGCAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_033446.1-356s1c1
Sequence:CCGGGATACCTGTGTTTCACAAGATCTCGAGATCTTGTGAAACACAGGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033446.1-181s1c1
Sequence:CCGGGAAGTCAAAGACCTCTCAGAACTCGAGTTCTGAGAGGTCTTTGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033446.1-558s1c1
Sequence:CCGGGATTTGTGACATTCGGATCATCTCGAGATGATCCGAATGTCACAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_033446.1-889s1c1
Sequence:CCGGGAAAGTATGCAGCCCTTTGATCTCGAGATCAAAGGGCTGCATACTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129255    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_033446.1-1958s1c1
Sequence:CCGGCGGGAACAAGTCATTCTGAAACTCGAGTTTCAGAATGACTTGTTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033446
VALIDATED
MVB12B MISSION shRNA shRNA Plasmid DNA
multivesicular body subunit 12B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033446.1-650s1c1
Sequence:CCGGGAATGGGCAGAGTACCAAGAACTCGAGTTCTTGGTACTCTGCCCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_033446.1-550s1c1
Sequence:CCGGGAAGCTGCGATTTGTGACATTCTCGAGAATGTCACAAATCGCAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_033446.1-356s1c1
Sequence:CCGGGATACCTGTGTTTCACAAGATCTCGAGATCTTGTGAAACACAGGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033446.1-181s1c1
Sequence:CCGGGAAGTCAAAGACCTCTCAGAACTCGAGTTCTGAGAGGTCTTTGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033446.1-558s1c1
Sequence:CCGGGATTTGTGACATTCGGATCATCTCGAGATGATCCGAATGTCACAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_033446.1-889s1c1
Sequence:CCGGGAAAGTATGCAGCCCTTTGATCTCGAGATCAAAGGGCTGCATACTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129255    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_033446.1-1958s1c1
Sequence:CCGGCGGGAACAAGTCATTCTGAAACTCGAGTTTCAGAATGACTTGTTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033446
VALIDATED
MVB12B MISSION shRNA Lentiviral Transduction Particles
multivesicular body subunit 12B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033446.1-650s1c1
Sequence:CCGGGAATGGGCAGAGTACCAAGAACTCGAGTTCTTGGTACTCTGCCCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_033446.1-550s1c1
Sequence:CCGGGAAGCTGCGATTTGTGACATTCTCGAGAATGTCACAAATCGCAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_033446.1-356s1c1
Sequence:CCGGGATACCTGTGTTTCACAAGATCTCGAGATCTTGTGAAACACAGGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033446.1-181s1c1
Sequence:CCGGGAAGTCAAAGACCTCTCAGAACTCGAGTTCTGAGAGGTCTTTGACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033446.1-558s1c1
Sequence:CCGGGATTTGTGACATTCGGATCATCTCGAGATGATCCGAATGTCACAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_033446.1-889s1c1
Sequence:CCGGGAAAGTATGCAGCCCTTTGATCTCGAGATCAAAGGGCTGCATACTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129255    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_033446.1-1958s1c1
Sequence:CCGGCGGGAACAAGTCATTCTGAAACTCGAGTTTCAGAATGACTTGTTCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175184
VALIDATED
MVB12B MISSION shRNA Bacterial Glycerol Stock
multivesicular body subunit 12B
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175184.3-978s1c1
Sequence:CCGGGCGGCTCTGCATTAAGTTTATCTCGAGATAAACTTAATGCAGAGCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175184.3-825s1c1
Sequence:CCGGCCTGTGTTTCACAAGATCATTCTCGAGAATGATCTTGTGAAACACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181303    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175184.3-1930s1c1
Sequence:CCGGCCAGGGTTGATTGCTTCACTTCTCGAGAAGTGAAGCAATCAACCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_175184.3-1389s1c1
Sequence:CCGGCATCAAGTCTCTGGCAGAAATCTCGAGATTTCTGCCAGAGACTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177450    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_175184.3-1706s1c1
Sequence:CCGGCGTTGTTCATAATTGTGACTACTCGAGTAGTCACAATTATGAACAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_175184.3-797s1c1
Sequence:CCGGGCTTATTCAAGTCCAAGGTTACTCGAGTAACCTTGGACTTGAATAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177516    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_175184.3-4059s1c1
Sequence:CCGGCGTAAGACCAAATCTAAGAATCTCGAGATTCTTAGATTTGGTCTTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175184
VALIDATED
MVB12B MISSION shRNA shRNA Plasmid DNA
multivesicular body subunit 12B
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175184.3-978s1c1
Sequence:CCGGGCGGCTCTGCATTAAGTTTATCTCGAGATAAACTTAATGCAGAGCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175184.3-825s1c1
Sequence:CCGGCCTGTGTTTCACAAGATCATTCTCGAGAATGATCTTGTGAAACACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181303    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175184.3-1930s1c1
Sequence:CCGGCCAGGGTTGATTGCTTCACTTCTCGAGAAGTGAAGCAATCAACCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_175184.3-1389s1c1
Sequence:CCGGCATCAAGTCTCTGGCAGAAATCTCGAGATTTCTGCCAGAGACTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177450    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_175184.3-1706s1c1
Sequence:CCGGCGTTGTTCATAATTGTGACTACTCGAGTAGTCACAATTATGAACAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_175184.3-797s1c1
Sequence:CCGGGCTTATTCAAGTCCAAGGTTACTCGAGTAACCTTGGACTTGAATAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177516    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_175184.3-4059s1c1
Sequence:CCGGCGTAAGACCAAATCTAAGAATCTCGAGATTCTTAGATTTGGTCTTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175184
VALIDATED
MVB12B MISSION shRNA Lentiviral Transduction Particles
multivesicular body subunit 12B
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175184.3-978s1c1
Sequence:CCGGGCGGCTCTGCATTAAGTTTATCTCGAGATAAACTTAATGCAGAGCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175184.3-825s1c1
Sequence:CCGGCCTGTGTTTCACAAGATCATTCTCGAGAATGATCTTGTGAAACACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181303    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175184.3-1930s1c1
Sequence:CCGGCCAGGGTTGATTGCTTCACTTCTCGAGAAGTGAAGCAATCAACCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_175184.3-1389s1c1
Sequence:CCGGCATCAAGTCTCTGGCAGAAATCTCGAGATTTCTGCCAGAGACTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177450    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_175184.3-1706s1c1
Sequence:CCGGCGTTGTTCATAATTGTGACTACTCGAGTAGTCACAATTATGAACAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_175184.3-797s1c1
Sequence:CCGGGCTTATTCAAGTCCAAGGTTACTCGAGTAACCTTGGACTTGAATAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177516    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_175184.3-4059s1c1
Sequence:CCGGCGTAAGACCAAATCTAAGAATCTCGAGATTCTTAGATTTGGTCTTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)